Incidental Mutation 'R1202:N4bp1'
ID100207
Institutional Source Beutler Lab
Gene Symbol N4bp1
Ensembl Gene ENSMUSG00000031652
Gene NameNEDD4 binding protein 1
Synonyms
MMRRC Submission 039272-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1202 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location86808160-86885258 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 86844887 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 828 (T828A)
Ref Sequence ENSEMBL: ENSMUSP00000034074 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034074]
Predicted Effect probably benign
Transcript: ENSMUST00000034074
AA Change: T828A

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000034074
Gene: ENSMUSG00000031652
AA Change: T828A

DomainStartEndE-ValueType
low complexity region 29 43 N/A INTRINSIC
low complexity region 375 390 N/A INTRINSIC
low complexity region 548 571 N/A INTRINSIC
Pfam:RNase_Zc3h12a 614 767 4.7e-59 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209389
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210029
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.8%
  • 10x: 94.6%
  • 20x: 86.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9430007A20Rik T C 4: 144,523,666 F137L probably benign Het
Cct3 T C 3: 88,318,528 probably null Het
Fermt3 A G 19: 7,003,482 F294L probably damaging Het
Fmn2 A T 1: 174,612,535 K58* probably null Het
Fndc5 G A 4: 129,139,445 V102M probably damaging Het
Gle1 C T 2: 29,949,265 A523V probably damaging Het
Hoxd11 C T 2: 74,682,577 A62V possibly damaging Het
Il23r A G 6: 67,478,953 V177A possibly damaging Het
Impdh2 G A 9: 108,563,187 R224Q probably damaging Het
Larp4b A G 13: 9,166,326 T516A possibly damaging Het
Mtmr2 T C 9: 13,803,452 Y431H probably benign Het
Nphp4 G A 4: 152,488,729 probably null Het
Nup155 A T 15: 8,157,760 H1391L probably damaging Het
Pabpc1l G T 2: 164,037,171 V313F possibly damaging Het
Pacs1 G A 19: 5,135,237 P885S probably damaging Het
Scn3a T C 2: 65,506,147 N705S probably benign Het
Sema4g G T 19: 44,998,257 R383L probably benign Het
Slc26a10 A G 10: 127,173,348 L648P probably damaging Het
St8sia2 A T 7: 73,972,035 V37E probably benign Het
Tmem209 C G 6: 30,508,790 V6L probably benign Het
Tmprss11a T A 5: 86,411,925 probably null Het
Ube2o C T 11: 116,541,582 D853N probably damaging Het
Usp17lb G A 7: 104,842,488 S6F probably damaging Het
Vmn2r74 G A 7: 85,961,337 T49I possibly damaging Het
Zfp236 T A 18: 82,628,166 T1041S probably benign Het
Other mutations in N4bp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00653:N4bp1 APN 8 86861726 missense probably benign 0.01
IGL00659:N4bp1 APN 8 86861802 missense probably damaging 1.00
IGL01484:N4bp1 APN 8 86844772 missense probably damaging 0.99
IGL01788:N4bp1 APN 8 86860996 missense probably benign 0.06
IGL01989:N4bp1 APN 8 86848487 missense probably damaging 1.00
IGL02619:N4bp1 APN 8 86860901 missense probably benign 0.01
IGL03290:N4bp1 APN 8 86848533 missense probably benign 0.31
Acorn UTSW 8 86861906 nonsense probably null
oak UTSW 8 86861796 nonsense probably null
Squirrel UTSW 8 86851709 missense probably damaging 1.00
Stash UTSW 8 86860424 critical splice donor site probably null
walnut UTSW 8 86846912 missense probably damaging 1.00
winter UTSW 8 86861683 missense probably benign
R0760:N4bp1 UTSW 8 86846912 missense probably damaging 1.00
R1653:N4bp1 UTSW 8 86844948 missense probably benign 0.10
R1878:N4bp1 UTSW 8 86861541 missense probably damaging 0.98
R2325:N4bp1 UTSW 8 86848460 missense probably damaging 1.00
R2442:N4bp1 UTSW 8 86862040 missense probably damaging 1.00
R2867:N4bp1 UTSW 8 86861405 missense probably benign 0.02
R2867:N4bp1 UTSW 8 86861405 missense probably benign 0.02
R2926:N4bp1 UTSW 8 86861796 nonsense probably null
R3625:N4bp1 UTSW 8 86851709 missense probably damaging 1.00
R3689:N4bp1 UTSW 8 86860556 missense probably damaging 1.00
R3863:N4bp1 UTSW 8 86860427 missense probably benign 0.13
R4872:N4bp1 UTSW 8 86861048 missense probably benign 0.01
R4902:N4bp1 UTSW 8 86861683 missense probably benign
R4965:N4bp1 UTSW 8 86851686 missense possibly damaging 0.69
R5070:N4bp1 UTSW 8 86860537 missense probably damaging 0.98
R5392:N4bp1 UTSW 8 86860420 splice site probably null
R5719:N4bp1 UTSW 8 86851684 missense probably damaging 1.00
R6280:N4bp1 UTSW 8 86853166 missense possibly damaging 0.68
R6292:N4bp1 UTSW 8 86853239 missense probably damaging 0.99
R6350:N4bp1 UTSW 8 86861968 missense probably damaging 0.99
R6543:N4bp1 UTSW 8 86861906 nonsense probably null
R6965:N4bp1 UTSW 8 86844833 missense probably damaging 1.00
R7120:N4bp1 UTSW 8 86860867 missense probably benign 0.01
R7172:N4bp1 UTSW 8 86860424 critical splice donor site probably null
R7791:N4bp1 UTSW 8 86853203 missense probably damaging 0.99
R8084:N4bp1 UTSW 8 86861008 missense probably benign 0.28
R8220:N4bp1 UTSW 8 86844687 makesense probably null
R8523:N4bp1 UTSW 8 86853161 missense probably damaging 1.00
R8753:N4bp1 UTSW 8 86848457 missense probably damaging 1.00
X0067:N4bp1 UTSW 8 86861920 missense probably damaging 1.00
Z1177:N4bp1 UTSW 8 86853159 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TCTTTCATGTACGGATGAGCTGCC -3'
(R):5'- AACGAGTGTGACCAGCCCTAAGAC -3'

Sequencing Primer
(F):5'- AAGATCTTTAGCAGCGCCTC -3'
(R):5'- TGTCAAATCCAGGGATGCTC -3'
Posted On2014-01-15