Incidental Mutation 'R1202:Impdh2'
ID100211
Institutional Source Beutler Lab
Gene Symbol Impdh2
Ensembl Gene ENSMUSG00000062867
Gene Nameinosine monophosphate dehydrogenase 2
SynonymsIMP dehydrogenase type II
MMRRC Submission 039272-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1202 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location108560286-108565584 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 108563187 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 224 (R224Q)
Ref Sequence ENSEMBL: ENSMUSP00000079888 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006851] [ENSMUST00000074208] [ENSMUST00000081111] [ENSMUST00000112155] [ENSMUST00000193421] [ENSMUST00000194381] [ENSMUST00000194904]
Predicted Effect probably benign
Transcript: ENSMUST00000006851
SMART Domains Protein: ENSMUSP00000006851
Gene: ENSMUSG00000006673

DomainStartEndE-ValueType
low complexity region 79 123 N/A INTRINSIC
low complexity region 128 146 N/A INTRINSIC
low complexity region 150 192 N/A INTRINSIC
low complexity region 419 443 N/A INTRINSIC
low complexity region 457 478 N/A INTRINSIC
Pfam:DUF3504 597 761 1.8e-65 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000074208
SMART Domains Protein: ENSMUSP00000073832
Gene: ENSMUSG00000070283

DomainStartEndE-ValueType
Pfam:DUF498 61 169 9.3e-37 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000081111
AA Change: R224Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000079888
Gene: ENSMUSG00000062867
AA Change: R224Q

DomainStartEndE-ValueType
IMPDH 28 504 7.39e-260 SMART
CBS 117 168 9.4e-7 SMART
CBS 184 232 1.57e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112155
SMART Domains Protein: ENSMUSP00000107782
Gene: ENSMUSG00000006673

DomainStartEndE-ValueType
low complexity region 79 123 N/A INTRINSIC
low complexity region 128 146 N/A INTRINSIC
low complexity region 150 192 N/A INTRINSIC
low complexity region 419 443 N/A INTRINSIC
low complexity region 457 478 N/A INTRINSIC
Pfam:DUF3504 600 760 2.3e-64 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193193
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193242
Predicted Effect possibly damaging
Transcript: ENSMUST00000193421
AA Change: R199Q

PolyPhen 2 Score 0.953 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000142117
Gene: ENSMUSG00000062867
AA Change: R199Q

DomainStartEndE-ValueType
IMPDH 28 248 1.3e-18 SMART
CBS 92 143 4.5e-9 SMART
CBS 159 207 7.6e-11 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193493
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193535
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194104
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194139
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194365
Predicted Effect probably benign
Transcript: ENSMUST00000194381
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194387
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194666
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194689
Predicted Effect probably damaging
Transcript: ENSMUST00000194904
AA Change: R18Q

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000142305
Gene: ENSMUSG00000062867
AA Change: R18Q

DomainStartEndE-ValueType
IMPDH 1 319 5e-122 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195456
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.8%
  • 10x: 94.6%
  • 20x: 86.8%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for disruptions in this gene have abnormalities resulting in embryonic lethality around the time of implantation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9430007A20Rik T C 4: 144,523,666 F137L probably benign Het
Cct3 T C 3: 88,318,528 probably null Het
Fermt3 A G 19: 7,003,482 F294L probably damaging Het
Fmn2 A T 1: 174,612,535 K58* probably null Het
Fndc5 G A 4: 129,139,445 V102M probably damaging Het
Gle1 C T 2: 29,949,265 A523V probably damaging Het
Hoxd11 C T 2: 74,682,577 A62V possibly damaging Het
Il23r A G 6: 67,478,953 V177A possibly damaging Het
Larp4b A G 13: 9,166,326 T516A possibly damaging Het
Mtmr2 T C 9: 13,803,452 Y431H probably benign Het
N4bp1 T C 8: 86,844,887 T828A probably benign Het
Nphp4 G A 4: 152,488,729 probably null Het
Nup155 A T 15: 8,157,760 H1391L probably damaging Het
Pabpc1l G T 2: 164,037,171 V313F possibly damaging Het
Pacs1 G A 19: 5,135,237 P885S probably damaging Het
Scn3a T C 2: 65,506,147 N705S probably benign Het
Sema4g G T 19: 44,998,257 R383L probably benign Het
Slc26a10 A G 10: 127,173,348 L648P probably damaging Het
St8sia2 A T 7: 73,972,035 V37E probably benign Het
Tmem209 C G 6: 30,508,790 V6L probably benign Het
Tmprss11a T A 5: 86,411,925 probably null Het
Ube2o C T 11: 116,541,582 D853N probably damaging Het
Usp17lb G A 7: 104,842,488 S6F probably damaging Het
Vmn2r74 G A 7: 85,961,337 T49I possibly damaging Het
Zfp236 T A 18: 82,628,166 T1041S probably benign Het
Other mutations in Impdh2
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0032:Impdh2 UTSW 9 108561661 missense probably damaging 1.00
R0523:Impdh2 UTSW 9 108561819 unclassified probably null
R0523:Impdh2 UTSW 9 108561820 missense possibly damaging 0.80
R0644:Impdh2 UTSW 9 108563637 missense possibly damaging 0.56
R0648:Impdh2 UTSW 9 108563466 missense probably benign 0.01
R0905:Impdh2 UTSW 9 108561097 unclassified probably benign
R1173:Impdh2 UTSW 9 108561829 missense probably benign 0.19
R1441:Impdh2 UTSW 9 108564776 missense probably benign 0.12
R1818:Impdh2 UTSW 9 108563212 unclassified probably null
R2141:Impdh2 UTSW 9 108565347 missense possibly damaging 0.50
R2173:Impdh2 UTSW 9 108565394 splice site probably null
R2438:Impdh2 UTSW 9 108560616 missense probably benign 0.06
R4061:Impdh2 UTSW 9 108562804 missense possibly damaging 0.46
R4273:Impdh2 UTSW 9 108564956 missense probably damaging 1.00
R4847:Impdh2 UTSW 9 108564671 missense probably damaging 1.00
R4847:Impdh2 UTSW 9 108565515 missense probably benign 0.00
R5073:Impdh2 UTSW 9 108563336 critical splice donor site probably null
R5896:Impdh2 UTSW 9 108563966 missense probably benign 0.06
R6315:Impdh2 UTSW 9 108563439 missense possibly damaging 0.66
R7172:Impdh2 UTSW 9 108560610 missense probably benign 0.00
R7182:Impdh2 UTSW 9 108563208 missense possibly damaging 0.56
R7241:Impdh2 UTSW 9 108563437 missense possibly damaging 0.78
X0066:Impdh2 UTSW 9 108561787 missense probably benign 0.33
Predicted Primers PCR Primer
(F):5'- GGCGTCACTCTGAAAGAGGCAAATG -3'
(R):5'- AGATGGAGTTTCCCTGGGAAGAGTC -3'

Sequencing Primer
(F):5'- gtcctggctgtcctagaac -3'
(R):5'- TTCCCTGGGAAGAGTCCTAGAAC -3'
Posted On2014-01-15