Incidental Mutation 'R1179:Pnisr'
ID100212
Institutional Source Beutler Lab
Gene Symbol Pnisr
Ensembl Gene ENSMUSG00000028248
Gene NamePNN interacting serine/arginine-rich
SynonymsSfrs18, 5730406M06Rik
MMRRC Submission 039251-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.943) question?
Stock #R1179 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location21847583-21876475 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 21865937 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 309 (T309A)
Ref Sequence ENSEMBL: ENSMUSP00000095840 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029911] [ENSMUST00000098238] [ENSMUST00000108229] [ENSMUST00000185001]
Predicted Effect possibly damaging
Transcript: ENSMUST00000029911
AA Change: T309A

PolyPhen 2 Score 0.955 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000029911
Gene: ENSMUSG00000028248
AA Change: T309A

DomainStartEndE-ValueType
low complexity region 1 27 N/A INTRINSIC
internal_repeat_1 57 86 6.59e-5 PROSPERO
low complexity region 94 117 N/A INTRINSIC
internal_repeat_1 121 149 6.59e-5 PROSPERO
low complexity region 181 194 N/A INTRINSIC
Pfam:PNISR 223 391 1.1e-55 PFAM
low complexity region 429 449 N/A INTRINSIC
low complexity region 494 586 N/A INTRINSIC
low complexity region 592 640 N/A INTRINSIC
low complexity region 664 703 N/A INTRINSIC
low complexity region 746 783 N/A INTRINSIC
low complexity region 789 814 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000098238
AA Change: T309A

PolyPhen 2 Score 0.955 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000095840
Gene: ENSMUSG00000028248
AA Change: T309A

DomainStartEndE-ValueType
low complexity region 1 27 N/A INTRINSIC
internal_repeat_1 57 86 7.37e-5 PROSPERO
low complexity region 94 117 N/A INTRINSIC
internal_repeat_1 121 149 7.37e-5 PROSPERO
low complexity region 181 194 N/A INTRINSIC
coiled coil region 240 276 N/A INTRINSIC
low complexity region 289 298 N/A INTRINSIC
low complexity region 318 331 N/A INTRINSIC
low complexity region 334 347 N/A INTRINSIC
low complexity region 376 415 N/A INTRINSIC
low complexity region 429 449 N/A INTRINSIC
low complexity region 494 586 N/A INTRINSIC
low complexity region 592 640 N/A INTRINSIC
low complexity region 664 703 N/A INTRINSIC
low complexity region 746 783 N/A INTRINSIC
low complexity region 789 805 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108229
AA Change: T309A

PolyPhen 2 Score 0.092 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000103864
Gene: ENSMUSG00000028248
AA Change: T309A

DomainStartEndE-ValueType
low complexity region 1 27 N/A INTRINSIC
low complexity region 94 117 N/A INTRINSIC
low complexity region 181 194 N/A INTRINSIC
coiled coil region 240 276 N/A INTRINSIC
low complexity region 289 298 N/A INTRINSIC
low complexity region 318 331 N/A INTRINSIC
low complexity region 334 347 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150368
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150927
Predicted Effect probably benign
Transcript: ENSMUST00000185001
AA Change: T309A

PolyPhen 2 Score 0.092 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000139324
Gene: ENSMUSG00000028248
AA Change: T309A

DomainStartEndE-ValueType
low complexity region 1 27 N/A INTRINSIC
low complexity region 94 117 N/A INTRINSIC
low complexity region 181 194 N/A INTRINSIC
coiled coil region 240 276 N/A INTRINSIC
low complexity region 289 298 N/A INTRINSIC
low complexity region 318 331 N/A INTRINSIC
low complexity region 334 347 N/A INTRINSIC
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.5%
  • 10x: 93.7%
  • 20x: 84.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy1 T A 11: 7,167,054 probably null Het
Aknad1 T C 3: 108,752,467 S266P possibly damaging Het
Gaa A T 11: 119,281,128 R686W probably damaging Het
Gls2 A T 10: 128,199,234 T79S probably damaging Het
Golga2 G T 2: 32,303,695 R511L possibly damaging Het
Hrnr T C 3: 93,332,543 S3363P unknown Het
Ift81 T C 5: 122,602,710 K187R probably benign Het
Kcnj1 T A 9: 32,396,766 I162N probably damaging Het
Ltbp1 A G 17: 75,225,285 Q118R possibly damaging Het
Mc5r C G 18: 68,338,670 probably null Het
Naga T A 15: 82,330,156 N385Y probably benign Het
Naip5 T A 13: 100,219,830 E1092D probably benign Het
Nrbp1 T A 5: 31,245,813 I210N probably damaging Het
Nrip3 A G 7: 109,763,555 V163A probably damaging Het
Olfr771 A C 10: 129,160,058 S309A probably benign Het
Olfr972 T C 9: 39,874,075 S267P possibly damaging Het
Pacsin3 A G 2: 91,263,860 E378G probably damaging Het
Rad54l A T 4: 116,111,320 L93Q probably benign Het
Ralgps2 G T 1: 156,901,799 P50Q probably damaging Het
Stab2 A G 10: 86,950,301 V594A probably damaging Het
Tenm2 C T 11: 36,063,177 G1236R possibly damaging Het
Tmem17 A T 11: 22,518,454 N131I probably damaging Het
Trrap G A 5: 144,777,939 R107H possibly damaging Het
Vmp1 T C 11: 86,607,229 T287A probably damaging Het
Zfp423 T A 8: 87,688,072 H1185L probably damaging Het
Zfp773 AGCTGCTGCTGCTGCTGCTGCTGCTGC AGCTGCTGCTGCTGCTGCTGCTGC 7: 7,133,093 probably benign Het
Other mutations in Pnisr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00499:Pnisr APN 4 21870407 critical splice donor site probably null
IGL01467:Pnisr APN 4 21874650 unclassified probably benign
IGL01997:Pnisr APN 4 21871537 missense possibly damaging 0.95
IGL02641:Pnisr APN 4 21860908 missense probably benign 0.03
IGL02756:Pnisr APN 4 21862175 missense probably benign 0.07
R0106:Pnisr UTSW 4 21874617 unclassified probably benign
R0106:Pnisr UTSW 4 21874617 unclassified probably benign
R0620:Pnisr UTSW 4 21874092 unclassified probably benign
R0636:Pnisr UTSW 4 21873800 unclassified probably benign
R1388:Pnisr UTSW 4 21862041 missense possibly damaging 0.88
R1450:Pnisr UTSW 4 21874912 critical splice acceptor site probably null
R1609:Pnisr UTSW 4 21871440 nonsense probably null
R1663:Pnisr UTSW 4 21873857 unclassified probably benign
R1670:Pnisr UTSW 4 21865893 missense probably damaging 1.00
R1721:Pnisr UTSW 4 21874086 unclassified probably benign
R1792:Pnisr UTSW 4 21860968 missense possibly damaging 0.94
R1867:Pnisr UTSW 4 21874086 unclassified probably benign
R1868:Pnisr UTSW 4 21874086 unclassified probably benign
R1909:Pnisr UTSW 4 21869517 missense possibly damaging 0.88
R1931:Pnisr UTSW 4 21873612 missense probably benign 0.01
R4843:Pnisr UTSW 4 21857400 intron probably benign
R4917:Pnisr UTSW 4 21859330 intron probably benign
R5076:Pnisr UTSW 4 21874990 unclassified probably benign
R5164:Pnisr UTSW 4 21859237 missense possibly damaging 0.88
R5227:Pnisr UTSW 4 21874587 unclassified probably benign
R6722:Pnisr UTSW 4 21859165 missense probably damaging 0.99
R7878:Pnisr UTSW 4 21874370 missense unknown
R7961:Pnisr UTSW 4 21874370 missense unknown
Z1088:Pnisr UTSW 4 21873684 missense probably benign
Z1176:Pnisr UTSW 4 21873684 missense probably benign
Z1177:Pnisr UTSW 4 21873684 missense probably benign
Predicted Primers
Posted On2014-01-15