Incidental Mutation 'R1202:Larp4b'
ID100219
Institutional Source Beutler Lab
Gene Symbol Larp4b
Ensembl Gene ENSMUSG00000033499
Gene NameLa ribonucleoprotein domain family, member 4B
SynonymsLarp5, D13Wsu64e
MMRRC Submission 039272-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.835) question?
Stock #R1202 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location9093881-9174451 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 9166326 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 516 (T516A)
Ref Sequence ENSEMBL: ENSMUSP00000139578 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091829] [ENSMUST00000188211] [ENSMUST00000188939]
Predicted Effect possibly damaging
Transcript: ENSMUST00000091829
AA Change: T432A

PolyPhen 2 Score 0.551 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000089437
Gene: ENSMUSG00000033499
AA Change: T432A

DomainStartEndE-ValueType
LA 156 234 3.25e-36 SMART
RRM 239 309 6.25e-2 SMART
low complexity region 510 529 N/A INTRINSIC
low complexity region 586 597 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000188211
AA Change: T516A

PolyPhen 2 Score 0.842 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000140993
Gene: ENSMUSG00000033499
AA Change: T516A

DomainStartEndE-ValueType
LA 156 234 3.25e-36 SMART
RRM 239 309 6.25e-2 SMART
low complexity region 510 529 N/A INTRINSIC
low complexity region 586 597 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000188939
AA Change: T516A

PolyPhen 2 Score 0.842 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000139578
Gene: ENSMUSG00000033499
AA Change: T516A

DomainStartEndE-ValueType
LA 156 234 3.25e-36 SMART
RRM 239 309 6.25e-2 SMART
low complexity region 510 529 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189330
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.8%
  • 10x: 94.6%
  • 20x: 86.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of an evolutionarily conserved protein family implicated in RNA metabolism and translation. Members of this family are characterized by the presence of an La motif, which is often located adjacent to one or more RNA recognition motifs (RRM). Together, the two motifs constitute the functional region of the protein and enable its interaction with the RNA substrate. This protein family is divided into five sub-families: the genuine La proteins and four La-related protein (LARP) sub-families. The protein encoded by this gene belongs to LARP sub-family 4. It is a cytoplasmic protein that may play a stimulatory role in translation. [provided by RefSeq, Oct 2012]
Allele List at MGI
Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9430007A20Rik T C 4: 144,523,666 F137L probably benign Het
Cct3 T C 3: 88,318,528 probably null Het
Fermt3 A G 19: 7,003,482 F294L probably damaging Het
Fmn2 A T 1: 174,612,535 K58* probably null Het
Fndc5 G A 4: 129,139,445 V102M probably damaging Het
Gle1 C T 2: 29,949,265 A523V probably damaging Het
Hoxd11 C T 2: 74,682,577 A62V possibly damaging Het
Il23r A G 6: 67,478,953 V177A possibly damaging Het
Impdh2 G A 9: 108,563,187 R224Q probably damaging Het
Mtmr2 T C 9: 13,803,452 Y431H probably benign Het
N4bp1 T C 8: 86,844,887 T828A probably benign Het
Nphp4 G A 4: 152,488,729 probably null Het
Nup155 A T 15: 8,157,760 H1391L probably damaging Het
Pabpc1l G T 2: 164,037,171 V313F possibly damaging Het
Pacs1 G A 19: 5,135,237 P885S probably damaging Het
Scn3a T C 2: 65,506,147 N705S probably benign Het
Sema4g G T 19: 44,998,257 R383L probably benign Het
Slc26a10 A G 10: 127,173,348 L648P probably damaging Het
St8sia2 A T 7: 73,972,035 V37E probably benign Het
Tmem209 C G 6: 30,508,790 V6L probably benign Het
Tmprss11a T A 5: 86,411,925 probably null Het
Ube2o C T 11: 116,541,582 D853N probably damaging Het
Usp17lb G A 7: 104,842,488 S6F probably damaging Het
Vmn2r74 G A 7: 85,961,337 T49I possibly damaging Het
Zfp236 T A 18: 82,628,166 T1041S probably benign Het
Other mutations in Larp4b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01746:Larp4b APN 13 9158124 missense probably damaging 0.99
IGL02519:Larp4b APN 13 9158580 missense probably benign 0.04
IGL02609:Larp4b APN 13 9170680 missense probably damaging 1.00
R0116:Larp4b UTSW 13 9170688 missense probably damaging 1.00
R0390:Larp4b UTSW 13 9158107 splice site probably null
R0585:Larp4b UTSW 13 9147493 missense probably damaging 1.00
R0585:Larp4b UTSW 13 9170701 missense probably benign 0.08
R0751:Larp4b UTSW 13 9166309 splice site probably benign
R1184:Larp4b UTSW 13 9166309 splice site probably benign
R1525:Larp4b UTSW 13 9145450 missense probably damaging 1.00
R1599:Larp4b UTSW 13 9122150 missense probably damaging 1.00
R1637:Larp4b UTSW 13 9151097 missense probably benign 0.12
R1833:Larp4b UTSW 13 9151199 missense possibly damaging 0.89
R1852:Larp4b UTSW 13 9137303 critical splice donor site probably null
R1962:Larp4b UTSW 13 9136842 missense probably benign
R2359:Larp4b UTSW 13 9158163 missense probably damaging 0.97
R2973:Larp4b UTSW 13 9166311 splice site probably benign
R3803:Larp4b UTSW 13 9158554 missense probably benign 0.03
R4810:Larp4b UTSW 13 9158591 missense probably benign
R4828:Larp4b UTSW 13 9170898 missense probably damaging 1.00
R5135:Larp4b UTSW 13 9170737 missense probably damaging 1.00
R5250:Larp4b UTSW 13 9170977 utr 3 prime probably benign
R5259:Larp4b UTSW 13 9158184 missense probably damaging 0.98
R5379:Larp4b UTSW 13 9136909 missense probably benign 0.17
R5436:Larp4b UTSW 13 9168900 missense possibly damaging 0.93
R5616:Larp4b UTSW 13 9158659 missense probably damaging 0.98
R5774:Larp4b UTSW 13 9170643 splice site probably null
R5818:Larp4b UTSW 13 9158560 missense probably benign
R6007:Larp4b UTSW 13 9168757 missense probably benign 0.13
R6248:Larp4b UTSW 13 9158702 missense probably benign 0.01
R6452:Larp4b UTSW 13 9147467 missense probably damaging 0.98
R6501:Larp4b UTSW 13 9168793 missense probably damaging 1.00
R7324:Larp4b UTSW 13 9158580 missense probably benign 0.04
R7689:Larp4b UTSW 13 9136798 missense probably damaging 1.00
R7737:Larp4b UTSW 13 9170643 splice site probably null
R7955:Larp4b UTSW 13 9136780 missense probably benign 0.00
R8877:Larp4b UTSW 13 9143799 missense probably benign 0.04
RF017:Larp4b UTSW 13 9123910 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- GTAAGGGCTCATAGCTGGGTGAAC -3'
(R):5'- CCTGGGTCAAGTCCTGGTACAAATC -3'

Sequencing Primer
(F):5'- gtggttcccaggggttaag -3'
(R):5'- TGGTACAAATCAGTGCCTAGAAAAC -3'
Posted On2014-01-15