Incidental Mutation 'R1202:Fermt3'
ID100229
Institutional Source Beutler Lab
Gene Symbol Fermt3
Ensembl Gene ENSMUSG00000024965
Gene Namefermitin family member 3
SynonymsKindlin-3, C79673
MMRRC Submission 039272-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1202 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location6998958-7019469 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 7003482 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 294 (F294L)
Ref Sequence ENSEMBL: ENSMUSP00000037858 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040772] [ENSMUST00000088223]
Predicted Effect probably damaging
Transcript: ENSMUST00000040772
AA Change: F294L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000037858
Gene: ENSMUSG00000024965
AA Change: F294L

DomainStartEndE-ValueType
Blast:B41 14 77 6e-32 BLAST
B41 94 556 1.66e-28 SMART
PH 350 455 2.26e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000088223
SMART Domains Protein: ENSMUSP00000085555
Gene: ENSMUSG00000047656

DomainStartEndE-ValueType
Pfam:PTS_2-RNA 21 198 2.6e-67 PFAM
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.8%
  • 10x: 94.6%
  • 20x: 86.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Kindlins are a small family of proteins that mediate protein-protein interactions involved in integrin activation and thereby have a role in cell adhesion, migration, differentiation, and proliferation. The protein encoded by this gene has a key role in the regulation of hemostasis and thrombosis. This protein may also help maintain the membrane skeleton of erythrocytes. Mutations in this gene cause the autosomal recessive leukocyte adhesion deficiency syndrome-III (LAD-III). Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Jan 2010]
PHENOTYPE: Disruption of this marker results in lethality in the first week after birth, abnormal erythropoiesis and platelet function, and severe hemorrhage. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9430007A20Rik T C 4: 144,523,666 F137L probably benign Het
Cct3 T C 3: 88,318,528 probably null Het
Fmn2 A T 1: 174,612,535 K58* probably null Het
Fndc5 G A 4: 129,139,445 V102M probably damaging Het
Gle1 C T 2: 29,949,265 A523V probably damaging Het
Hoxd11 C T 2: 74,682,577 A62V possibly damaging Het
Il23r A G 6: 67,478,953 V177A possibly damaging Het
Impdh2 G A 9: 108,563,187 R224Q probably damaging Het
Larp4b A G 13: 9,166,326 T516A possibly damaging Het
Mtmr2 T C 9: 13,803,452 Y431H probably benign Het
N4bp1 T C 8: 86,844,887 T828A probably benign Het
Nphp4 G A 4: 152,488,729 probably null Het
Nup155 A T 15: 8,157,760 H1391L probably damaging Het
Pabpc1l G T 2: 164,037,171 V313F possibly damaging Het
Pacs1 G A 19: 5,135,237 P885S probably damaging Het
Scn3a T C 2: 65,506,147 N705S probably benign Het
Sema4g G T 19: 44,998,257 R383L probably benign Het
Slc26a10 A G 10: 127,173,348 L648P probably damaging Het
St8sia2 A T 7: 73,972,035 V37E probably benign Het
Tmem209 C G 6: 30,508,790 V6L probably benign Het
Tmprss11a T A 5: 86,411,925 probably null Het
Ube2o C T 11: 116,541,582 D853N probably damaging Het
Usp17lb G A 7: 104,842,488 S6F probably damaging Het
Vmn2r74 G A 7: 85,961,337 T49I possibly damaging Het
Zfp236 T A 18: 82,628,166 T1041S probably benign Het
Other mutations in Fermt3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01160:Fermt3 APN 19 7003258 unclassified probably null
IGL01724:Fermt3 APN 19 7001775 missense probably damaging 0.99
IGL01748:Fermt3 APN 19 7003466 critical splice donor site probably null
IGL02392:Fermt3 APN 19 7018815 missense probably benign 0.35
IGL02956:Fermt3 APN 19 7002344 missense probably benign 0.40
IGL03146:Fermt3 APN 19 7003263 missense possibly damaging 0.88
IGL03216:Fermt3 APN 19 6999380 missense probably benign 0.00
P0026:Fermt3 UTSW 19 7014424 missense probably damaging 0.99
R0180:Fermt3 UTSW 19 7002343 missense possibly damaging 0.76
R0445:Fermt3 UTSW 19 7003299 missense probably benign 0.29
R1475:Fermt3 UTSW 19 7018874 intron probably null
R1668:Fermt3 UTSW 19 7018692 missense probably damaging 1.00
R2179:Fermt3 UTSW 19 7014414 missense probably benign 0.14
R2311:Fermt3 UTSW 19 7014162 missense probably damaging 0.97
R3976:Fermt3 UTSW 19 7002424 missense possibly damaging 0.74
R4087:Fermt3 UTSW 19 7003577 critical splice acceptor site probably null
R4667:Fermt3 UTSW 19 7002920 missense probably damaging 1.00
R6108:Fermt3 UTSW 19 7014414 missense probably benign 0.14
R6452:Fermt3 UTSW 19 7014737 missense probably benign 0.00
R6994:Fermt3 UTSW 19 6999727 missense probably damaging 1.00
R7334:Fermt3 UTSW 19 7003038 missense probably benign 0.03
R7357:Fermt3 UTSW 19 7002843 missense probably benign
Z1177:Fermt3 UTSW 19 7014679 missense probably benign 0.29
Predicted Primers PCR Primer
(F):5'- AGGCCCATCTTTCCTACAGAGCAC -3'
(R):5'- GTAGCTTCTGGCACAGTAGAGCAG -3'

Sequencing Primer
(F):5'- GAGCACCTATGAAGTACCCTGG -3'
(R):5'- TTCATAGAGAGCTGCACTGC -3'
Posted On2014-01-15