Incidental Mutation 'R1179:Kcnj1'
ID100230
Institutional Source Beutler Lab
Gene Symbol Kcnj1
Ensembl Gene ENSMUSG00000041248
Gene Namepotassium inwardly-rectifying channel, subfamily J, member 1
SynonymsKir1.1, ROMK, ROMK-2
MMRRC Submission 039251-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.064) question?
Stock #R1179 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location32372493-32399197 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 32396766 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 162 (I162N)
Ref Sequence ENSEMBL: ENSMUSP00000131625 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047334] [ENSMUST00000172015] [ENSMUST00000213393]
Predicted Effect possibly damaging
Transcript: ENSMUST00000047334
AA Change: I142N

PolyPhen 2 Score 0.874 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000046793
Gene: ENSMUSG00000041248
AA Change: I142N

DomainStartEndE-ValueType
Pfam:IRK 24 361 1.4e-155 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000172015
AA Change: I162N

PolyPhen 2 Score 0.962 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000131625
Gene: ENSMUSG00000041248
AA Change: I162N

DomainStartEndE-ValueType
Pfam:IRK 44 373 7.6e-144 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000213393
AA Change: I142N

PolyPhen 2 Score 0.874 (Sensitivity: 0.83; Specificity: 0.93)
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.5%
  • 10x: 93.7%
  • 20x: 84.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Potassium channels are present in most mammalian cells, where they participate in a wide range of physiologic responses. The protein encoded by this gene is an integral membrane protein and inward-rectifier type potassium channel. It is activated by internal ATP and probably plays an important role in potassium homeostasis. The encoded protein has a greater tendency to allow potassium to flow into a cell rather than out of a cell. Mutations in this gene have been associated with antenatal Bartter syndrome, which is characterized by salt wasting, hypokalemic alkalosis, hypercalciuria, and low blood pressure. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Most homozygotes for a null mutation die before weaning with impaired electrolyte, acid-base, and fluid-volume homeostasis, reduced NaCl absorption in the thick ascending limb, and abnormal tubuloglomerular feedback. A colony of mutants with extended suvival serves as a model for Bartter's syndrome. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy1 T A 11: 7,167,054 probably null Het
Aknad1 T C 3: 108,752,467 S266P possibly damaging Het
Gaa A T 11: 119,281,128 R686W probably damaging Het
Gls2 A T 10: 128,199,234 T79S probably damaging Het
Golga2 G T 2: 32,303,695 R511L possibly damaging Het
Hrnr T C 3: 93,332,543 S3363P unknown Het
Ift81 T C 5: 122,602,710 K187R probably benign Het
Ltbp1 A G 17: 75,225,285 Q118R possibly damaging Het
Mc5r C G 18: 68,338,670 probably null Het
Naga T A 15: 82,330,156 N385Y probably benign Het
Naip5 T A 13: 100,219,830 E1092D probably benign Het
Nrbp1 T A 5: 31,245,813 I210N probably damaging Het
Nrip3 A G 7: 109,763,555 V163A probably damaging Het
Olfr771 A C 10: 129,160,058 S309A probably benign Het
Olfr972 T C 9: 39,874,075 S267P possibly damaging Het
Pacsin3 A G 2: 91,263,860 E378G probably damaging Het
Pnisr A G 4: 21,865,937 T309A possibly damaging Het
Rad54l A T 4: 116,111,320 L93Q probably benign Het
Ralgps2 G T 1: 156,901,799 P50Q probably damaging Het
Stab2 A G 10: 86,950,301 V594A probably damaging Het
Tenm2 C T 11: 36,063,177 G1236R possibly damaging Het
Tmem17 A T 11: 22,518,454 N131I probably damaging Het
Trrap G A 5: 144,777,939 R107H possibly damaging Het
Vmp1 T C 11: 86,607,229 T287A probably damaging Het
Zfp423 T A 8: 87,688,072 H1185L probably damaging Het
Zfp773 AGCTGCTGCTGCTGCTGCTGCTGCTGC AGCTGCTGCTGCTGCTGCTGCTGC 7: 7,133,093 probably benign Het
Other mutations in Kcnj1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00941:Kcnj1 APN 9 32396498 missense probably benign 0.01
IGL02958:Kcnj1 APN 9 32396555 missense probably damaging 1.00
IGL03285:Kcnj1 APN 9 32396861 missense possibly damaging 0.67
R1503:Kcnj1 UTSW 9 32396492 missense probably damaging 0.98
R1918:Kcnj1 UTSW 9 32396738 missense probably benign 0.00
R4439:Kcnj1 UTSW 9 32394118 intron probably benign
R4659:Kcnj1 UTSW 9 32394148 missense probably benign
R4661:Kcnj1 UTSW 9 32396622 missense probably benign 0.14
R4917:Kcnj1 UTSW 9 32396760 missense probably damaging 0.99
R4918:Kcnj1 UTSW 9 32396760 missense probably damaging 0.99
R5385:Kcnj1 UTSW 9 32396723 missense probably damaging 1.00
R6017:Kcnj1 UTSW 9 32394104 intron probably benign
R6036:Kcnj1 UTSW 9 32397125 missense probably benign 0.15
R6036:Kcnj1 UTSW 9 32397125 missense probably benign 0.15
R6117:Kcnj1 UTSW 9 32397182 missense probably damaging 1.00
R6245:Kcnj1 UTSW 9 32396867 missense probably damaging 1.00
R6316:Kcnj1 UTSW 9 32397336 missense probably damaging 0.96
R6585:Kcnj1 UTSW 9 32397261 missense probably benign
R6988:Kcnj1 UTSW 9 32396585 missense probably benign 0.17
R7116:Kcnj1 UTSW 9 32396981 missense possibly damaging 0.91
R7393:Kcnj1 UTSW 9 32397018 missense probably damaging 1.00
Predicted Primers
Posted On2014-01-15