Incidental Mutation 'R1202:Sema4g'
ID100231
Institutional Source Beutler Lab
Gene Symbol Sema4g
Ensembl Gene ENSMUSG00000025207
Gene Namesema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4G
Synonyms
MMRRC Submission 039272-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1202 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location44989101-45003397 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 44998257 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 383 (R383L)
Ref Sequence ENSEMBL: ENSMUSP00000137395 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026225] [ENSMUST00000130549] [ENSMUST00000179305]
Predicted Effect probably benign
Transcript: ENSMUST00000026225
AA Change: R383L

PolyPhen 2 Score 0.311 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000026225
Gene: ENSMUSG00000025207
AA Change: R383L

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Sema 56 487 2.38e-165 SMART
PSI 505 556 6.59e-13 SMART
IG 567 649 6.26e-5 SMART
low complexity region 650 666 N/A INTRINSIC
transmembrane domain 677 699 N/A INTRINSIC
low complexity region 701 708 N/A INTRINSIC
low complexity region 713 720 N/A INTRINSIC
low complexity region 734 751 N/A INTRINSIC
low complexity region 761 774 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000130549
AA Change: R383L

PolyPhen 2 Score 0.311 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000138321
Gene: ENSMUSG00000025207
AA Change: R383L

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Sema 56 487 2.38e-165 SMART
PSI 505 556 6.59e-13 SMART
IG 567 649 6.26e-5 SMART
low complexity region 650 666 N/A INTRINSIC
transmembrane domain 677 699 N/A INTRINSIC
low complexity region 701 708 N/A INTRINSIC
low complexity region 713 720 N/A INTRINSIC
low complexity region 734 751 N/A INTRINSIC
low complexity region 761 774 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000179305
AA Change: R383L

PolyPhen 2 Score 0.311 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000137395
Gene: ENSMUSG00000025207
AA Change: R383L

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Sema 56 487 2.38e-165 SMART
PSI 505 556 6.59e-13 SMART
IG 567 649 6.26e-5 SMART
low complexity region 650 666 N/A INTRINSIC
transmembrane domain 677 699 N/A INTRINSIC
low complexity region 701 708 N/A INTRINSIC
low complexity region 713 720 N/A INTRINSIC
low complexity region 734 751 N/A INTRINSIC
low complexity region 761 774 N/A INTRINSIC
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.8%
  • 10x: 94.6%
  • 20x: 86.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Semaphorins are a large family of conserved secreted and membrane associated proteins which possess a semaphorin (Sema) domain and a PSI domain (found in plexins, semaphorins and integrins) in the N-terminal extracellular portion. Based on sequence and structural similarities, semaphorins are put into eight classes: invertebrates contain classes 1 and 2, viruses have class V, and vertebrates contain classes 3-7. Semaphorins serve as axon guidance ligands via multimeric receptor complexes, some (if not all) containing plexin proteins. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2011]
PHENOTYPE: Mice homozygous for a targeted allele exhibit normal cerebellar morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9430007A20Rik T C 4: 144,523,666 F137L probably benign Het
Cct3 T C 3: 88,318,528 probably null Het
Fermt3 A G 19: 7,003,482 F294L probably damaging Het
Fmn2 A T 1: 174,612,535 K58* probably null Het
Fndc5 G A 4: 129,139,445 V102M probably damaging Het
Gle1 C T 2: 29,949,265 A523V probably damaging Het
Hoxd11 C T 2: 74,682,577 A62V possibly damaging Het
Il23r A G 6: 67,478,953 V177A possibly damaging Het
Impdh2 G A 9: 108,563,187 R224Q probably damaging Het
Larp4b A G 13: 9,166,326 T516A possibly damaging Het
Mtmr2 T C 9: 13,803,452 Y431H probably benign Het
N4bp1 T C 8: 86,844,887 T828A probably benign Het
Nphp4 G A 4: 152,488,729 probably null Het
Nup155 A T 15: 8,157,760 H1391L probably damaging Het
Pabpc1l G T 2: 164,037,171 V313F possibly damaging Het
Pacs1 G A 19: 5,135,237 P885S probably damaging Het
Scn3a T C 2: 65,506,147 N705S probably benign Het
Slc26a10 A G 10: 127,173,348 L648P probably damaging Het
St8sia2 A T 7: 73,972,035 V37E probably benign Het
Tmem209 C G 6: 30,508,790 V6L probably benign Het
Tmprss11a T A 5: 86,411,925 probably null Het
Ube2o C T 11: 116,541,582 D853N probably damaging Het
Usp17lb G A 7: 104,842,488 S6F probably damaging Het
Vmn2r74 G A 7: 85,961,337 T49I possibly damaging Het
Zfp236 T A 18: 82,628,166 T1041S probably benign Het
Other mutations in Sema4g
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01414:Sema4g APN 19 44997996 missense probably damaging 1.00
IGL01419:Sema4g APN 19 44997396 missense probably benign 0.00
IGL02033:Sema4g APN 19 44997415 missense probably damaging 1.00
IGL02092:Sema4g APN 19 44992639 critical splice donor site probably null
IGL02148:Sema4g APN 19 44996469 missense probably damaging 1.00
IGL02829:Sema4g APN 19 44992749 missense possibly damaging 0.95
IGL02837:Sema4g UTSW 19 44996711 missense probably damaging 0.96
R0550:Sema4g UTSW 19 44997665 missense probably benign
R0675:Sema4g UTSW 19 44997587 missense probably damaging 1.00
R1346:Sema4g UTSW 19 44997652 missense possibly damaging 0.65
R1533:Sema4g UTSW 19 44992817 missense probably damaging 1.00
R1763:Sema4g UTSW 19 45001605 nonsense probably null
R1775:Sema4g UTSW 19 44999242 critical splice donor site probably null
R1803:Sema4g UTSW 19 44998020 missense probably benign 0.05
R1832:Sema4g UTSW 19 44999017 missense probably benign
R1909:Sema4g UTSW 19 44997622 missense probably damaging 0.96
R4035:Sema4g UTSW 19 45001414 missense probably damaging 0.99
R4131:Sema4g UTSW 19 44998919 missense probably benign
R4611:Sema4g UTSW 19 45001612 missense probably damaging 1.00
R4951:Sema4g UTSW 19 44996571 splice site probably null
R5921:Sema4g UTSW 19 44998704 missense probably benign 0.04
R7573:Sema4g UTSW 19 44997571 missense probably damaging 0.96
R8099:Sema4g UTSW 19 44992528 missense probably damaging 1.00
R8169:Sema4g UTSW 19 44998971 missense probably damaging 1.00
R8354:Sema4g UTSW 19 44998427 missense probably benign 0.01
X0011:Sema4g UTSW 19 44998869 splice site probably null
Z1177:Sema4g UTSW 19 44998047 missense probably benign 0.03
Z1177:Sema4g UTSW 19 45001881 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCAGCCATCTGCCGCTATGAC -3'
(R):5'- AAGCACCTGTGCCCAGAAAGAG -3'

Sequencing Primer
(F):5'- CAGGCCCTTTTATGGAGTACCAG -3'
(R):5'- TGCCCAGAAAGAGCAGGTC -3'
Posted On2014-01-15