Incidental Mutation 'R1179:Olfr972'
ID100232
Institutional Source Beutler Lab
Gene Symbol Olfr972
Ensembl Gene ENSMUSG00000094449
Gene Nameolfactory receptor 972
SynonymsMOR171-17, GA_x6K02T2PVTD-33572803-33573747
MMRRC Submission 039251-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1179 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location39866422-39874651 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 39874075 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 267 (S267P)
Ref Sequence ENSEMBL: ENSMUSP00000150498 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079767] [ENSMUST00000215303] [ENSMUST00000216167]
Predicted Effect possibly damaging
Transcript: ENSMUST00000079767
AA Change: S267P

PolyPhen 2 Score 0.780 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000078700
Gene: ENSMUSG00000094449
AA Change: S267P

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 7.1e-54 PFAM
Pfam:7tm_1 41 290 2.1e-21 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000215303
AA Change: S267P

PolyPhen 2 Score 0.780 (Sensitivity: 0.85; Specificity: 0.93)
Predicted Effect possibly damaging
Transcript: ENSMUST00000216167
AA Change: S267P

PolyPhen 2 Score 0.780 (Sensitivity: 0.85; Specificity: 0.93)
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.5%
  • 10x: 93.7%
  • 20x: 84.3%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy1 T A 11: 7,167,054 probably null Het
Aknad1 T C 3: 108,752,467 S266P possibly damaging Het
Gaa A T 11: 119,281,128 R686W probably damaging Het
Gls2 A T 10: 128,199,234 T79S probably damaging Het
Golga2 G T 2: 32,303,695 R511L possibly damaging Het
Hrnr T C 3: 93,332,543 S3363P unknown Het
Ift81 T C 5: 122,602,710 K187R probably benign Het
Kcnj1 T A 9: 32,396,766 I162N probably damaging Het
Ltbp1 A G 17: 75,225,285 Q118R possibly damaging Het
Mc5r C G 18: 68,338,670 probably null Het
Naga T A 15: 82,330,156 N385Y probably benign Het
Naip5 T A 13: 100,219,830 E1092D probably benign Het
Nrbp1 T A 5: 31,245,813 I210N probably damaging Het
Nrip3 A G 7: 109,763,555 V163A probably damaging Het
Olfr771 A C 10: 129,160,058 S309A probably benign Het
Pacsin3 A G 2: 91,263,860 E378G probably damaging Het
Pnisr A G 4: 21,865,937 T309A possibly damaging Het
Rad54l A T 4: 116,111,320 L93Q probably benign Het
Ralgps2 G T 1: 156,901,799 P50Q probably damaging Het
Stab2 A G 10: 86,950,301 V594A probably damaging Het
Tenm2 C T 11: 36,063,177 G1236R possibly damaging Het
Tmem17 A T 11: 22,518,454 N131I probably damaging Het
Trrap G A 5: 144,777,939 R107H possibly damaging Het
Vmp1 T C 11: 86,607,229 T287A probably damaging Het
Zfp423 T A 8: 87,688,072 H1185L probably damaging Het
Zfp773 AGCTGCTGCTGCTGCTGCTGCTGCTGC AGCTGCTGCTGCTGCTGCTGCTGC 7: 7,133,093 probably benign Het
Other mutations in Olfr972
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01805:Olfr972 APN 9 39873779 missense probably damaging 1.00
IGL02008:Olfr972 APN 9 39873485 missense probably damaging 1.00
IGL02556:Olfr972 APN 9 39873610 missense possibly damaging 0.73
IGL02991:Olfr972 UTSW 9 39874066 missense probably benign 0.36
R0494:Olfr972 UTSW 9 39873402 missense probably damaging 1.00
R0725:Olfr972 UTSW 9 39873347 missense probably damaging 0.99
R1500:Olfr972 UTSW 9 39873411 missense probably benign 0.36
R1796:Olfr972 UTSW 9 39873971 missense probably benign 0.12
R1970:Olfr972 UTSW 9 39873938 missense probably damaging 1.00
R2018:Olfr972 UTSW 9 39874058 missense probably benign 0.35
R4065:Olfr972 UTSW 9 39873422 missense possibly damaging 0.86
R5254:Olfr972 UTSW 9 39873445 missense possibly damaging 0.94
R5799:Olfr972 UTSW 9 39874096 missense possibly damaging 0.78
R6751:Olfr972 UTSW 9 39873680 missense probably benign 0.00
R7525:Olfr972 UTSW 9 39874139 nonsense probably null
R7570:Olfr972 UTSW 9 39873455 missense possibly damaging 0.59
R7803:Olfr972 UTSW 9 39874082 missense probably benign 0.23
Predicted Primers
Posted On2014-01-15