Mutagenetix > Incidental Mutation

Incidental Mutation 'R1179:Gls2'

100235

Institutional Source

Beutler Lab

Gene Symbol

Gls2

Ensembl Gene

ENSMUSG00000044005

Gene Name

glutaminase 2 (liver, mitochondrial)

Synonyms

Lga, A330074B06Rik

MMRRC Submission

039251-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1179 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

128194457-128210004 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 128199234 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Serine at position 79 (T79S)

Ref Sequence

ENSEMBL: ENSMUSP00000119763 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000044776] [ENSMUST00000123291] [ENSMUST00000143827] [ENSMUST00000159440]

AlphaFold

Q571F8

Predicted Effect

probably benign
Transcript: ENSMUST00000044776
AA Change: T79S

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000047376
Gene: ENSMUSG00000044005
AA Change: T79S

Domain	Start	End	E-Value	Type
Pfam:Glutaminase	177	463	1.1e-116	PFAM
ANK	518	548	3.76e-5	SMART
ANK	552	581	1.21e1	SMART

Predicted Effect

silent
Transcript: ENSMUST00000123291

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000123385

Predicted Effect

unknown
Transcript: ENSMUST00000134104
AA Change: T71S

SMART Domains

Protein: ENSMUSP00000123436
Gene: ENSMUSG00000044005
AA Change: T71S

Domain	Start	End	E-Value	Type
PDB:4JKT\|D	60	172	1e-48	PDB
low complexity region	191	201	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000134461

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000135441

Predicted Effect

probably damaging
Transcript: ENSMUST00000143827
AA Change: T79S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000119763
Gene: ENSMUSG00000044005
AA Change: T79S

Domain	Start	End	E-Value	Type
PDB:4JKT\|D	67	135	5e-25	PDB
low complexity region	170	186	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000145591

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000152928

Predicted Effect

probably damaging
Transcript: ENSMUST00000159440
AA Change: T79S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000124239
Gene: ENSMUSG00000044005
AA Change: T79S

Domain	Start	End	E-Value	Type
PDB:4JKT\|D	67	134	9e-25	PDB

Coding Region Coverage

1x: 98.8%
3x: 97.5%
10x: 93.7%
20x: 84.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a mitochondrial phosphate-activated glutaminase that catalyzes the hydrolysis of glutamine to stoichiometric amounts of glutamate and ammonia. Originally thought to be liver-specific, this protein has been found in other tissues as well. Alternative splicing results in multiple transcript variants that encode different isoforms. [provided by RefSeq, Jul 2013]

Allele List at MGI

Other mutations in this stock

Total: 26 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adcy1	T	A	11: 7,167,054		probably null	Het
Aknad1	T	C	3: 108,752,467	S266P	possibly damaging	Het
Gaa	A	T	11: 119,281,128	R686W	probably damaging	Het
Golga2	G	T	2: 32,303,695	R511L	possibly damaging	Het
Hrnr	T	C	3: 93,332,543	S3363P	unknown	Het
Ift81	T	C	5: 122,602,710	K187R	probably benign	Het
Kcnj1	T	A	9: 32,396,766	I162N	probably damaging	Het
Ltbp1	A	G	17: 75,225,285	Q118R	possibly damaging	Het
Mc5r	C	G	18: 68,338,670		probably null	Het
Naga	T	A	15: 82,330,156	N385Y	probably benign	Het
Naip5	T	A	13: 100,219,830	E1092D	probably benign	Het
Nrbp1	T	A	5: 31,245,813	I210N	probably damaging	Het
Nrip3	A	G	7: 109,763,555	V163A	probably damaging	Het
Olfr771	A	C	10: 129,160,058	S309A	probably benign	Het
Olfr972	T	C	9: 39,874,075	S267P	possibly damaging	Het
Pacsin3	A	G	2: 91,263,860	E378G	probably damaging	Het
Pnisr	A	G	4: 21,865,937	T309A	possibly damaging	Het
Rad54l	A	T	4: 116,111,320	L93Q	probably benign	Het
Ralgps2	G	T	1: 156,901,799	P50Q	probably damaging	Het
Stab2	A	G	10: 86,950,301	V594A	probably damaging	Het
Tenm2	C	T	11: 36,063,177	G1236R	possibly damaging	Het
Tmem17	A	T	11: 22,518,454	N131I	probably damaging	Het
Trrap	G	A	5: 144,777,939	R107H	possibly damaging	Het
Vmp1	T	C	11: 86,607,229	T287A	probably damaging	Het
Zfp423	T	A	8: 87,688,072	H1185L	probably damaging	Het
Zfp773	AGCTGCTGCTGCTGCTGCTGCTGCTGC	AGCTGCTGCTGCTGCTGCTGCTGC	7: 7,133,093		probably benign	Het

Other mutations in Gls2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00088:Gls2	APN	10	128200971	splice site	probably null
IGL00583:Gls2	APN	10	128204882	missense	probably benign	0.11
IGL01444:Gls2	APN	10	128201347	missense	probably damaging	1.00
IGL02746:Gls2	APN	10	128200956	missense	probably damaging	1.00
R0015:Gls2	UTSW	10	128209350	missense	probably damaging	1.00
R0024:Gls2	UTSW	10	128199256	missense	probably damaging	1.00
R0378:Gls2	UTSW	10	128207311	missense	probably benign
R1227:Gls2	UTSW	10	128199664	missense	probably damaging	1.00
R1421:Gls2	UTSW	10	128201348	nonsense	probably null
R1750:Gls2	UTSW	10	128201325	missense	probably damaging	1.00
R1952:Gls2	UTSW	10	128209362	missense	probably benign
R2218:Gls2	UTSW	10	128204714	missense	probably damaging	1.00
R2291:Gls2	UTSW	10	128207610	nonsense	probably null
R2382:Gls2	UTSW	10	128203842	missense	probably damaging	1.00
R4536:Gls2	UTSW	10	128200937	missense	probably benign	0.00
R5305:Gls2	UTSW	10	128204709	nonsense	probably null
R5435:Gls2	UTSW	10	128195126	intron	probably benign
R5767:Gls2	UTSW	10	128205221	missense	probably damaging	1.00
R7223:Gls2	UTSW	10	128199194	missense	probably benign
R7767:Gls2	UTSW	10	128195129	missense	unknown
R8068:Gls2	UTSW	10	128195114	missense	unknown
R8084:Gls2	UTSW	10	128199256	missense	probably damaging	1.00
R8329:Gls2	UTSW	10	128201285	missense	probably benign	0.00
R8872:Gls2	UTSW	10	128204666	missense	probably benign	0.00

Predicted Primers

Posted On

2014-01-15