Mutagenetix > Incidental Mutations

Incidental Mutation 'R1203:Nphp4'

100250

Institutional Source

Beutler Lab

Gene Symbol

Nphp4

Ensembl Gene

ENSMUSG00000039577

Gene Name

nephronophthisis 4 (juvenile) homolog (human)

Synonyms

nmf192, 4930564O18Rik

MMRRC Submission

039273-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.178) question?

Stock #

R1203 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

152476706-152563183 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 152488832 bp

Zygosity

Heterozygous

Amino Acid Change

Lysine to Glutamic Acid at position 76 (K76E)

Ref Sequence

ENSEMBL: ENSMUSP00000080128 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000056567] [ENSMUST00000081393]

Predicted Effect

probably damaging
Transcript: ENSMUST00000056567
AA Change: K76E

PolyPhen 2 Score 0.962 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000049920
Gene: ENSMUSG00000039577
AA Change: K76E

Domain	Start	End	E-Value	Type
low complexity region	317	333	N/A	INTRINSIC
low complexity region	367	380	N/A	INTRINSIC
low complexity region	473	484	N/A	INTRINSIC
low complexity region	507	530	N/A	INTRINSIC
low complexity region	896	909	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000081393
AA Change: K76E

PolyPhen 2 Score 0.962 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000080128
Gene: ENSMUSG00000039577
AA Change: K76E

Domain	Start	End	E-Value	Type
low complexity region	317	333	N/A	INTRINSIC
low complexity region	367	380	N/A	INTRINSIC
low complexity region	473	484	N/A	INTRINSIC
low complexity region	507	530	N/A	INTRINSIC
low complexity region	896	909	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000142027

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000146223

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000153759

Meta Mutation Damage Score

0.1

Coding Region Coverage

1x: 99.5%
3x: 98.4%
10x: 95.6%
20x: 89.3%

Validation Efficiency

100% (50/50)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein involved in renal tubular development and function. This protein interacts with nephrocystin, and belongs to a multifunctional complex that is localized to actin- and microtubule-based structures. Mutations in this gene are associated with nephronophthisis type 4, a renal disease, and with Senior-Loken syndrome type 4, a combination of nephronophthisis and retinitis pigmentosa. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2014]
PHENOTYPE: Mutant mice have a mottled retina with photoreceptor degeneration and male infertility associated with oligozoospermia and asthenozoospermia. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 44 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A830018L16Rik	A	T	1: 11,518,594	R78S	probably damaging	Het
Aadacl3	T	C	4: 144,463,570	T54A	probably benign	Het
Adcy8	A	G	15: 64,746,931	I791T	probably damaging	Het
Aldh1b1	A	G	4: 45,803,359	D299G	probably damaging	Het
Aoah	A	G	13: 20,816,594	E66G	probably damaging	Het
Atl2	G	T	17: 79,852,905	H418N	probably damaging	Het
Atp6v1d	A	G	12: 78,861,440	I7T	possibly damaging	Het
Calhm3	C	T	19: 47,155,400	V155M	probably damaging	Het
Carmil1	A	T	13: 24,099,006	I105K	probably damaging	Het
Csrp3	C	A	7: 48,839,530	M1I	probably null	Het
Dnah10	T	A	5: 124,760,014		probably null	Het
Dnah11	T	C	12: 117,933,812	N3561S	possibly damaging	Het
Dzip3	A	T	16: 48,951,817	D496E	probably damaging	Het
Eif2ak1	T	C	5: 143,883,979	V246A	probably benign	Het
Fam171b	T	A	2: 83,812,969	V74E	probably benign	Het
Gm14137	C	T	2: 119,175,124	R55W	probably damaging	Het
Gm4950	T	C	18: 51,865,758	I42V	probably benign	Het
Gpr35	T	C	1: 92,983,148	V194A	probably damaging	Het
Kdm5d	C	T	Y: 941,011	S1132F	probably damaging	Het
Muc4	C	A	16: 32,754,529	H1468N	probably benign	Het
Ncln	A	G	10: 81,496,193	V24A	possibly damaging	Het
Nsf	CAATAATAATAATAATA	CAATAATAATAATAATAATA	11: 103,926,126		probably benign	Het
Nup155	A	T	15: 8,157,760	H1391L	probably damaging	Het
Olfr649	A	T	7: 104,189,853	L118*	probably null	Het
Pabpc1l	G	T	2: 164,037,171	V313F	possibly damaging	Het
Pcbd2	G	A	13: 55,733,068		probably null	Het
Rapgef6	T	A	11: 54,691,699	V1479D	probably benign	Het
Rnf43	T	C	11: 87,727,475		probably benign	Het
Robo3	A	G	9: 37,418,682	W1113R	probably damaging	Het
Sall1	A	T	8: 89,031,934	V514E	probably damaging	Het
Sgpp1	A	G	12: 75,716,282	I375T	probably benign	Het
Strc	T	C	2: 121,372,123	N1187S	possibly damaging	Het
Tbc1d17	G	A	7: 44,843,471	R363W	probably damaging	Het
Tbcd	A	G	11: 121,475,625	Q242R	probably benign	Het
Tbcel	A	C	9: 42,451,651	V50G	probably damaging	Het
Tead3	C	T	17: 28,341,562	A23T	probably benign	Het
Tedc2	T	A	17: 24,216,317	E366V	probably damaging	Het
Tedc2	C	A	17: 24,216,318	E366*	probably null	Het
Tmem136	A	G	9: 43,111,480	V193A	probably benign	Het
Tmem241	G	T	18: 12,083,978		probably benign	Het
Tmtc3	G	T	10: 100,476,744	T79K	probably damaging	Het
Utrn	A	G	10: 12,486,537	V241A	probably damaging	Het
Vps8	A	T	16: 21,511,557	I729F	probably damaging	Het
Zfp407	C	T	18: 84,559,773	A1072T	probably benign	Het

Other mutations in Nphp4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00922:Nphp4	APN	4	152537309	splice site	probably benign
IGL00963:Nphp4	APN	4	152537861	missense	probably benign	0.01
IGL01571:Nphp4	APN	4	152556382	missense	probably benign	0.21
IGL01707:Nphp4	APN	4	152538983	missense	probably benign	0.00
IGL01837:Nphp4	APN	4	152488881	missense	probably damaging	0.96
IGL02341:Nphp4	APN	4	152555469	splice site	probably benign
IGL02558:Nphp4	APN	4	152555531	missense	probably damaging	1.00
IGL02563:Nphp4	APN	4	152556220	missense	probably benign	0.00
IGL02712:Nphp4	APN	4	152556275	missense	probably damaging	1.00
IGL03023:Nphp4	APN	4	152524235	splice site	probably null
R0280:Nphp4	UTSW	4	152551936	splice site	probably benign
R0317:Nphp4	UTSW	4	152551931	critical splice donor site	probably null
R0410:Nphp4	UTSW	4	152557046	missense	probably benign
R0433:Nphp4	UTSW	4	152518172	missense	probably benign	0.00
R0706:Nphp4	UTSW	4	152555617	missense	probably damaging	0.98
R0785:Nphp4	UTSW	4	152562109	missense	possibly damaging	0.58
R0890:Nphp4	UTSW	4	152498220	missense	possibly damaging	0.93
R0930:Nphp4	UTSW	4	152538055	missense	probably benign	0.01
R1202:Nphp4	UTSW	4	152488729	splice site	probably null
R1366:Nphp4	UTSW	4	152502926	missense	probably damaging	0.96
R1452:Nphp4	UTSW	4	152547018	missense	probably damaging	0.99
R1598:Nphp4	UTSW	4	152562090	missense	probably benign	0.00
R1699:Nphp4	UTSW	4	152496664	missense	probably damaging	0.99
R2007:Nphp4	UTSW	4	152554654	missense	probably damaging	0.97
R2082:Nphp4	UTSW	4	152559364	missense	probably benign	0.38
R2264:Nphp4	UTSW	4	152503008	splice site	probably benign
R2280:Nphp4	UTSW	4	152557043	missense	possibly damaging	0.95
R2281:Nphp4	UTSW	4	152557043	missense	possibly damaging	0.95
R2926:Nphp4	UTSW	4	152518139	missense	probably damaging	0.99
R3764:Nphp4	UTSW	4	152538017	splice site	probably benign
R4084:Nphp4	UTSW	4	152488791	missense	probably damaging	1.00
R4091:Nphp4	UTSW	4	152547018	missense	probably damaging	0.97
R4240:Nphp4	UTSW	4	152555684	missense	probably benign	0.07
R4701:Nphp4	UTSW	4	152496659	missense	probably damaging	1.00
R4778:Nphp4	UTSW	4	152556291	missense	probably benign	0.44
R4783:Nphp4	UTSW	4	152554546	missense	probably benign	0.00
R4784:Nphp4	UTSW	4	152554546	missense	probably benign	0.00
R4974:Nphp4	UTSW	4	152537793	missense	probably damaging	1.00
R5053:Nphp4	UTSW	4	152544462	splice site	probably null
R5117:Nphp4	UTSW	4	152524232	splice site	probably null
R5128:Nphp4	UTSW	4	152502991	missense	probably benign	0.01
R5665:Nphp4	UTSW	4	152506485	missense	probably benign	0.25
R5890:Nphp4	UTSW	4	152547079	missense	probably benign	0.44
R6171:Nphp4	UTSW	4	152544449	missense	probably damaging	0.99
R6601:Nphp4	UTSW	4	152503007	splice site	probably null
R6772:Nphp4	UTSW	4	152544406	missense	probably benign	0.07
R6806:Nphp4	UTSW	4	152538101	missense	probably benign	0.02
R7006:Nphp4	UTSW	4	152488802	missense	probably benign	0.12
R7124:Nphp4	UTSW	4	152555684	missense	probably benign	0.07
R7381:Nphp4	UTSW	4	152499003	missense	possibly damaging	0.94
R7411:Nphp4	UTSW	4	152554717	missense	probably benign	0.25
T0970:Nphp4	UTSW	4	152556379	missense	probably damaging	1.00
X0058:Nphp4	UTSW	4	152559707	missense	possibly damaging	0.95

Predicted Primers

PCR Primer
(F):5'- TGTCACAAGGAAGTTGAGTTGCCAG -3'
(R):5'- TGATGCGACAGACACTCTACCTCAC -3'

Sequencing Primer
(F):5'- TGAGTTGCCAGTAGCTGAATG -3'
(R):5'- TTTGGAAACAGAGTGTCCCAC -3'

Posted On

2014-01-15