Incidental Mutation 'R1203:Eif2ak1'
Institutional Source Beutler Lab
Gene Symbol Eif2ak1
Ensembl Gene ENSMUSG00000029613
Gene Nameeukaryotic translation initiation factor 2 alpha kinase 1
MMRRC Submission 039273-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.149) question?
Stock #R1203 (G1)
Quality Score209
Status Validated
Chromosomal Location143817788-143904251 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 143883979 bp
Amino Acid Change Valine to Alanine at position 246 (V246A)
Ref Sequence ENSEMBL: ENSMUSP00000098056 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100487]
Predicted Effect probably benign
Transcript: ENSMUST00000100487
AA Change: V246A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000098056
Gene: ENSMUSG00000029613
AA Change: V246A

low complexity region 12 28 N/A INTRINSIC
low complexity region 62 81 N/A INTRINSIC
Pfam:Pkinase_Tyr 167 242 5.6e-6 PFAM
Pfam:Pkinase 167 257 1.9e-15 PFAM
low complexity region 314 320 N/A INTRINSIC
Pfam:Pkinase 365 580 1.3e-31 PFAM
Pfam:Pkinase_Tyr 373 578 1.9e-19 PFAM
coiled coil region 585 619 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140013
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.4%
  • 10x: 95.6%
  • 20x: 89.3%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene acts at the level of translation initiation to downregulate protein synthesis in response to stress. The encoded protein is a kinase that can be inactivated by hemin. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit enlarged heart size and abnormal red blood cell development, morphology, and physiology with macrocytic anemia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A830018L16Rik A T 1: 11,518,594 R78S probably damaging Het
Aadacl3 T C 4: 144,463,570 T54A probably benign Het
Adcy8 A G 15: 64,746,931 I791T probably damaging Het
Aldh1b1 A G 4: 45,803,359 D299G probably damaging Het
Aoah A G 13: 20,816,594 E66G probably damaging Het
Atl2 G T 17: 79,852,905 H418N probably damaging Het
Atp6v1d A G 12: 78,861,440 I7T possibly damaging Het
Calhm3 C T 19: 47,155,400 V155M probably damaging Het
Carmil1 A T 13: 24,099,006 I105K probably damaging Het
Csrp3 C A 7: 48,839,530 M1I probably null Het
Dnah10 T A 5: 124,760,014 probably null Het
Dnah11 T C 12: 117,933,812 N3561S possibly damaging Het
Dzip3 A T 16: 48,951,817 D496E probably damaging Het
Fam171b T A 2: 83,812,969 V74E probably benign Het
Gm14137 C T 2: 119,175,124 R55W probably damaging Het
Gm4950 T C 18: 51,865,758 I42V probably benign Het
Gpr35 T C 1: 92,983,148 V194A probably damaging Het
Kdm5d C T Y: 941,011 S1132F probably damaging Het
Muc4 C A 16: 32,754,529 H1468N probably benign Het
Ncln A G 10: 81,496,193 V24A possibly damaging Het
Nphp4 A G 4: 152,488,832 K76E probably damaging Het
Nsf CAATAATAATAATAATA CAATAATAATAATAATAATA 11: 103,926,126 probably benign Het
Nup155 A T 15: 8,157,760 H1391L probably damaging Het
Olfr649 A T 7: 104,189,853 L118* probably null Het
Pabpc1l G T 2: 164,037,171 V313F possibly damaging Het
Pcbd2 G A 13: 55,733,068 probably null Het
Rapgef6 T A 11: 54,691,699 V1479D probably benign Het
Rnf43 T C 11: 87,727,475 probably benign Het
Robo3 A G 9: 37,418,682 W1113R probably damaging Het
Sall1 A T 8: 89,031,934 V514E probably damaging Het
Sgpp1 A G 12: 75,716,282 I375T probably benign Het
Strc T C 2: 121,372,123 N1187S possibly damaging Het
Tbc1d17 G A 7: 44,843,471 R363W probably damaging Het
Tbcd A G 11: 121,475,625 Q242R probably benign Het
Tbcel A C 9: 42,451,651 V50G probably damaging Het
Tead3 C T 17: 28,341,562 A23T probably benign Het
Tedc2 T A 17: 24,216,317 E366V probably damaging Het
Tedc2 C A 17: 24,216,318 E366* probably null Het
Tmem136 A G 9: 43,111,480 V193A probably benign Het
Tmem241 G T 18: 12,083,978 probably benign Het
Tmtc3 G T 10: 100,476,744 T79K probably damaging Het
Utrn A G 10: 12,486,537 V241A probably damaging Het
Vps8 A T 16: 21,511,557 I729F probably damaging Het
Zfp407 C T 18: 84,559,773 A1072T probably benign Het
Other mutations in Eif2ak1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00501:Eif2ak1 APN 5 143889470 missense probably damaging 0.99
IGL02170:Eif2ak1 APN 5 143879460 missense probably benign 0.01
IGL02472:Eif2ak1 APN 5 143884883 missense probably benign 0.00
IGL02898:Eif2ak1 APN 5 143889452 missense probably damaging 1.00
IGL03078:Eif2ak1 APN 5 143873769 missense probably benign 0.02
PIT4520001:Eif2ak1 UTSW 5 143899209 nonsense probably null
R0523:Eif2ak1 UTSW 5 143882166 missense probably damaging 1.00
R0755:Eif2ak1 UTSW 5 143884924 missense possibly damaging 0.94
R1128:Eif2ak1 UTSW 5 143899176 unclassified probably null
R1445:Eif2ak1 UTSW 5 143873899 splice site probably benign
R1474:Eif2ak1 UTSW 5 143871967 missense probably damaging 1.00
R1972:Eif2ak1 UTSW 5 143884714 missense probably benign 0.04
R3885:Eif2ak1 UTSW 5 143884661 missense probably benign 0.21
R3889:Eif2ak1 UTSW 5 143884661 missense probably benign 0.21
R4754:Eif2ak1 UTSW 5 143901803 missense probably damaging 0.99
R4971:Eif2ak1 UTSW 5 143882168 missense probably damaging 1.00
R5007:Eif2ak1 UTSW 5 143873880 missense probably benign
R5487:Eif2ak1 UTSW 5 143897163 critical splice acceptor site probably null
R5505:Eif2ak1 UTSW 5 143817990 missense probably benign
R5808:Eif2ak1 UTSW 5 143883994 missense probably benign 0.21
R5888:Eif2ak1 UTSW 5 143886915 missense probably damaging 1.00
R6290:Eif2ak1 UTSW 5 143884799 missense probably benign 0.34
R6322:Eif2ak1 UTSW 5 143899095 missense probably benign 0.05
R6475:Eif2ak1 UTSW 5 143818010 unclassified probably null
R7343:Eif2ak1 UTSW 5 143877671 missense probably damaging 1.00
R7525:Eif2ak1 UTSW 5 143886898 missense probably damaging 1.00
R7554:Eif2ak1 UTSW 5 143879478 missense probably damaging 1.00
R7659:Eif2ak1 UTSW 5 143889462 missense probably damaging 1.00
X0027:Eif2ak1 UTSW 5 143879435 missense probably damaging 1.00
Predicted Primers PCR Primer

Sequencing Primer
Posted On2014-01-15