Incidental Mutation 'R1179:Mc5r'
ID 100256
Institutional Source Beutler Lab
Gene Symbol Mc5r
Ensembl Gene ENSMUSG00000007480
Gene Name melanocortin 5 receptor
Synonyms
MMRRC Submission 039251-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.109) question?
Stock # R1179 (G1)
Quality Score 179
Status Not validated
Chromosome 18
Chromosomal Location 68337603-68339711 bp(+) (GRCm38)
Type of Mutation splice site
DNA Base Change (assembly) C to G at 68338670 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000130497 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000172148]
AlphaFold P41149
Predicted Effect probably null
Transcript: ENSMUST00000172148
SMART Domains Protein: ENSMUSP00000130497
Gene: ENSMUSG00000007480

DomainStartEndE-ValueType
low complexity region 49 62 N/A INTRINSIC
Pfam:7tm_4 90 314 1.6e-10 PFAM
Pfam:7TM_GPCR_Srsx 94 357 9.8e-10 PFAM
Pfam:7tm_1 100 342 6.2e-33 PFAM
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.5%
  • 10x: 93.7%
  • 20x: 84.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the seven-pass transmembrane G protein-coupled melanocortin receptor protein family that stimulate cAMP signal transduction. The encoded protein is a receptor for melanocyte-stimulating hormone and adrenocorticotropic hormone and is suggested to play a role in sebum generation. [provided by RefSeq, Jun 2010]
PHENOTYPE: Homozygous mutation of this gene results in a severe defect in water repulsion and thermoregulation due to decreased production of sebaceous lipids. Males exhibit less aggressive and more defensive behavior when placed with wildtype males. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy1 T A 11: 7,167,054 probably null Het
Aknad1 T C 3: 108,752,467 S266P possibly damaging Het
Gaa A T 11: 119,281,128 R686W probably damaging Het
Gls2 A T 10: 128,199,234 T79S probably damaging Het
Golga2 G T 2: 32,303,695 R511L possibly damaging Het
Hrnr T C 3: 93,332,543 S3363P unknown Het
Ift81 T C 5: 122,602,710 K187R probably benign Het
Kcnj1 T A 9: 32,396,766 I162N probably damaging Het
Ltbp1 A G 17: 75,225,285 Q118R possibly damaging Het
Naga T A 15: 82,330,156 N385Y probably benign Het
Naip5 T A 13: 100,219,830 E1092D probably benign Het
Nrbp1 T A 5: 31,245,813 I210N probably damaging Het
Nrip3 A G 7: 109,763,555 V163A probably damaging Het
Olfr771 A C 10: 129,160,058 S309A probably benign Het
Olfr972 T C 9: 39,874,075 S267P possibly damaging Het
Pacsin3 A G 2: 91,263,860 E378G probably damaging Het
Pnisr A G 4: 21,865,937 T309A possibly damaging Het
Rad54l A T 4: 116,111,320 L93Q probably benign Het
Ralgps2 G T 1: 156,901,799 P50Q probably damaging Het
Stab2 A G 10: 86,950,301 V594A probably damaging Het
Tenm2 C T 11: 36,063,177 G1236R possibly damaging Het
Tmem17 A T 11: 22,518,454 N131I probably damaging Het
Trrap G A 5: 144,777,939 R107H possibly damaging Het
Vmp1 T C 11: 86,607,229 T287A probably damaging Het
Zfp423 T A 8: 87,688,072 H1185L probably damaging Het
Zfp773 AGCTGCTGCTGCTGCTGCTGCTGCTGC AGCTGCTGCTGCTGCTGCTGCTGC 7: 7,133,093 probably benign Het
Other mutations in Mc5r
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01483:Mc5r APN 18 68339244 missense probably damaging 1.00
IGL02396:Mc5r APN 18 68339466 missense possibly damaging 0.88
IGL02474:Mc5r APN 18 68338839 missense probably damaging 1.00
IGL02489:Mc5r APN 18 68339526 missense probably damaging 0.99
IGL03323:Mc5r APN 18 68339215 missense probably benign 0.00
R0022:Mc5r UTSW 18 68338782 missense probably benign
R0022:Mc5r UTSW 18 68338782 missense probably benign
R0067:Mc5r UTSW 18 68339566 missense probably damaging 1.00
R0067:Mc5r UTSW 18 68339566 missense probably damaging 1.00
R0883:Mc5r UTSW 18 68339092 missense probably damaging 1.00
R1789:Mc5r UTSW 18 68338670 splice site probably null
R1866:Mc5r UTSW 18 68338670 splice site probably null
R2291:Mc5r UTSW 18 68339364 missense probably damaging 1.00
R4297:Mc5r UTSW 18 68339307 missense probably benign 0.00
R4960:Mc5r UTSW 18 68338819 missense possibly damaging 0.50
R5062:Mc5r UTSW 18 68339281 missense probably damaging 1.00
R5521:Mc5r UTSW 18 68339677 missense possibly damaging 0.73
R5853:Mc5r UTSW 18 68339493 missense probably benign 0.25
R6007:Mc5r UTSW 18 68339247 missense possibly damaging 0.93
R7326:Mc5r UTSW 18 68339668 missense probably damaging 1.00
R9160:Mc5r UTSW 18 68339134 missense probably damaging 1.00
R9287:Mc5r UTSW 18 68339129 missense probably damaging 1.00
R9471:Mc5r UTSW 18 68339056 missense probably damaging 1.00
R9511:Mc5r UTSW 18 68339494 missense possibly damaging 0.65
Predicted Primers
Posted On 2014-01-15