Incidental Mutation 'R1203:Tmtc3'
ID100270
Institutional Source Beutler Lab
Gene Symbol Tmtc3
Ensembl Gene ENSMUSG00000036676
Gene Nametransmembrane and tetratricopeptide repeat containing 3
SynonymsB130008E12Rik, mSmile, 9130014E20Rik
MMRRC Submission 039273-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.267) question?
Stock #R1203 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location100443902-100487350 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 100476744 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Lysine at position 79 (T79K)
Ref Sequence ENSEMBL: ENSMUSP00000121473 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058154] [ENSMUST00000099318] [ENSMUST00000128009] [ENSMUST00000134477]
Predicted Effect probably damaging
Transcript: ENSMUST00000058154
AA Change: T79K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000061470
Gene: ENSMUSG00000036676
AA Change: T79K

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
transmembrane domain 98 120 N/A INTRINSIC
transmembrane domain 141 163 N/A INTRINSIC
transmembrane domain 173 192 N/A INTRINSIC
transmembrane domain 205 227 N/A INTRINSIC
transmembrane domain 237 259 N/A INTRINSIC
Pfam:DUF1736 263 336 5.4e-35 PFAM
transmembrane domain 353 375 N/A INTRINSIC
transmembrane domain 382 399 N/A INTRINSIC
TPR 451 484 8.23e-6 SMART
TPR 485 518 2.13e1 SMART
TPR 533 567 8.77e1 SMART
TPR 568 601 3.19e-3 SMART
TPR 602 635 1.06e-8 SMART
TPR 673 706 1.35e-1 SMART
TPR 707 740 1.44e1 SMART
TPR 741 775 1.51e1 SMART
TPR 776 809 9e1 SMART
low complexity region 867 880 N/A INTRINSIC
low complexity region 891 902 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000099318
AA Change: T79K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000096921
Gene: ENSMUSG00000036676
AA Change: T79K

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
transmembrane domain 98 120 N/A INTRINSIC
transmembrane domain 141 163 N/A INTRINSIC
transmembrane domain 173 192 N/A INTRINSIC
transmembrane domain 205 227 N/A INTRINSIC
transmembrane domain 237 259 N/A INTRINSIC
Pfam:DUF1736 261 338 2.6e-33 PFAM
transmembrane domain 353 375 N/A INTRINSIC
transmembrane domain 382 399 N/A INTRINSIC
TPR 451 484 8.23e-6 SMART
TPR 485 518 2.13e1 SMART
TPR 533 567 8.77e1 SMART
TPR 568 601 3.19e-3 SMART
TPR 602 635 1.06e-8 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000128009
AA Change: T79K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130883
Predicted Effect probably benign
Transcript: ENSMUST00000134477
Meta Mutation Damage Score 0.308 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.4%
  • 10x: 95.6%
  • 20x: 89.3%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the transmembrane and tetratricopeptide repeat-containing protein family. [provided by RefSeq, May 2010]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit impaired bronchial smooth muscle and alveolar myofibroblast development that leads to cyanosis and postnatal lethality in some mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A830018L16Rik A T 1: 11,518,594 R78S probably damaging Het
Aadacl3 T C 4: 144,463,570 T54A probably benign Het
Adcy8 A G 15: 64,746,931 I791T probably damaging Het
Aldh1b1 A G 4: 45,803,359 D299G probably damaging Het
Aoah A G 13: 20,816,594 E66G probably damaging Het
Atl2 G T 17: 79,852,905 H418N probably damaging Het
Atp6v1d A G 12: 78,861,440 I7T possibly damaging Het
Calhm3 C T 19: 47,155,400 V155M probably damaging Het
Carmil1 A T 13: 24,099,006 I105K probably damaging Het
Csrp3 C A 7: 48,839,530 M1I probably null Het
Dnah10 T A 5: 124,760,014 probably null Het
Dnah11 T C 12: 117,933,812 N3561S possibly damaging Het
Dzip3 A T 16: 48,951,817 D496E probably damaging Het
Eif2ak1 T C 5: 143,883,979 V246A probably benign Het
Fam171b T A 2: 83,812,969 V74E probably benign Het
Gm14137 C T 2: 119,175,124 R55W probably damaging Het
Gm4950 T C 18: 51,865,758 I42V probably benign Het
Gpr35 T C 1: 92,983,148 V194A probably damaging Het
Kdm5d C T Y: 941,011 S1132F probably damaging Het
Muc4 C A 16: 32,754,529 H1468N probably benign Het
Ncln A G 10: 81,496,193 V24A possibly damaging Het
Nphp4 A G 4: 152,488,832 K76E probably damaging Het
Nsf CAATAATAATAATAATA CAATAATAATAATAATAATA 11: 103,926,126 probably benign Het
Nup155 A T 15: 8,157,760 H1391L probably damaging Het
Olfr649 A T 7: 104,189,853 L118* probably null Het
Pabpc1l G T 2: 164,037,171 V313F possibly damaging Het
Pcbd2 G A 13: 55,733,068 probably null Het
Rapgef6 T A 11: 54,691,699 V1479D probably benign Het
Rnf43 T C 11: 87,727,475 probably benign Het
Robo3 A G 9: 37,418,682 W1113R probably damaging Het
Sall1 A T 8: 89,031,934 V514E probably damaging Het
Sgpp1 A G 12: 75,716,282 I375T probably benign Het
Strc T C 2: 121,372,123 N1187S possibly damaging Het
Tbc1d17 G A 7: 44,843,471 R363W probably damaging Het
Tbcd A G 11: 121,475,625 Q242R probably benign Het
Tbcel A C 9: 42,451,651 V50G probably damaging Het
Tead3 C T 17: 28,341,562 A23T probably benign Het
Tedc2 T A 17: 24,216,317 E366V probably damaging Het
Tedc2 C A 17: 24,216,318 E366* probably null Het
Tmem136 A G 9: 43,111,480 V193A probably benign Het
Tmem241 G T 18: 12,083,978 probably benign Het
Utrn A G 10: 12,486,537 V241A probably damaging Het
Vps8 A T 16: 21,511,557 I729F probably damaging Het
Zfp407 C T 18: 84,559,773 A1072T probably benign Het
Other mutations in Tmtc3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00818:Tmtc3 APN 10 100471480 missense probably benign
IGL00962:Tmtc3 APN 10 100471953 missense probably damaging 1.00
IGL01670:Tmtc3 APN 10 100447125 missense probably benign 0.02
IGL01729:Tmtc3 APN 10 100447155 missense probably benign
IGL01933:Tmtc3 APN 10 100447605 missense probably benign 0.00
IGL01961:Tmtc3 APN 10 100447031 missense probably benign
IGL03063:Tmtc3 APN 10 100447606 missense probably benign 0.00
IGL03176:Tmtc3 APN 10 100466131 missense possibly damaging 0.57
IGL03195:Tmtc3 APN 10 100459034 missense probably benign 0.00
IGL03238:Tmtc3 APN 10 100477840 missense probably damaging 1.00
IGL03272:Tmtc3 APN 10 100457080 missense probably benign 0.00
IGL03335:Tmtc3 APN 10 100466254 missense probably damaging 0.97
IGL03375:Tmtc3 APN 10 100447719 missense possibly damaging 0.67
IGL03409:Tmtc3 APN 10 100451432 missense possibly damaging 0.75
R0078:Tmtc3 UTSW 10 100448961 missense probably damaging 1.00
R0121:Tmtc3 UTSW 10 100458908 splice site probably benign
R0234:Tmtc3 UTSW 10 100450322 missense probably benign 0.44
R0234:Tmtc3 UTSW 10 100450322 missense probably benign 0.44
R0480:Tmtc3 UTSW 10 100471404 missense probably damaging 1.00
R1136:Tmtc3 UTSW 10 100472043 unclassified probably benign
R1253:Tmtc3 UTSW 10 100451390 missense probably benign 0.05
R2181:Tmtc3 UTSW 10 100448973 missense probably benign 0.00
R3011:Tmtc3 UTSW 10 100447582 missense possibly damaging 0.76
R3430:Tmtc3 UTSW 10 100447575 missense probably benign 0.29
R3910:Tmtc3 UTSW 10 100449026 missense probably damaging 1.00
R3911:Tmtc3 UTSW 10 100449026 missense probably damaging 1.00
R3912:Tmtc3 UTSW 10 100449026 missense probably damaging 1.00
R4773:Tmtc3 UTSW 10 100457139 missense possibly damaging 0.66
R4838:Tmtc3 UTSW 10 100466220 missense probably damaging 1.00
R4996:Tmtc3 UTSW 10 100447224 missense probably damaging 0.99
R5131:Tmtc3 UTSW 10 100448979 missense probably damaging 1.00
R5976:Tmtc3 UTSW 10 100476672 missense probably benign 0.00
R6700:Tmtc3 UTSW 10 100471477 missense probably benign 0.00
R7187:Tmtc3 UTSW 10 100477912 missense probably damaging 1.00
R7211:Tmtc3 UTSW 10 100447605 missense probably benign 0.05
R7299:Tmtc3 UTSW 10 100447474 missense not run
R7301:Tmtc3 UTSW 10 100447474 missense not run
R7329:Tmtc3 UTSW 10 100447419 missense probably benign 0.00
R7509:Tmtc3 UTSW 10 100466094 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGTGCAGCCGTACTTACTGCC -3'
(R):5'- GTGCCGTAAATGTCCCCATACACC -3'

Sequencing Primer
(F):5'- CGTACTTACTGCCTCGGTATGG -3'
(R):5'- CCCATACACCTAGTCTGGAGG -3'
Posted On2014-01-15