Incidental Mutation 'R1203:Nsf'
ID 100276
Institutional Source Beutler Lab
Gene Symbol Nsf
Ensembl Gene ENSMUSG00000034187
Gene Name N-ethylmaleimide sensitive fusion protein
Synonyms N-ethylmaleimide sensitive factor, SKD2
MMRRC Submission 039273-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R1203 (G1)
Quality Score 217
Status Validated
Chromosome 11
Chromosomal Location 103712608-103844882 bp(-) (GRCm39)
Type of Mutation unclassified
DNA Base Change (assembly) CAATAATAATAATAATA to CAATAATAATAATAATAATA at 103816952 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000133603 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000103075] [ENSMUST00000133774] [ENSMUST00000149642]
AlphaFold P46460
Predicted Effect probably benign
Transcript: ENSMUST00000103075
SMART Domains Protein: ENSMUSP00000099364
Gene: ENSMUSG00000034187

DomainStartEndE-ValueType
CDC48_N 5 86 2.7e-16 SMART
CDC48_2 111 183 6.22e-7 SMART
AAA 252 399 3.65e-19 SMART
AAA 535 671 2.2e-13 SMART
low complexity region 674 683 N/A INTRINSIC
low complexity region 698 711 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000107009
Predicted Effect probably benign
Transcript: ENSMUST00000133774
SMART Domains Protein: ENSMUSP00000133591
Gene: ENSMUSG00000034187

DomainStartEndE-ValueType
Pfam:CDC48_N 1 51 1.5e-10 PFAM
CDC48_2 76 148 6.22e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140394
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145126
Predicted Effect probably benign
Transcript: ENSMUST00000149642
SMART Domains Protein: ENSMUSP00000133603
Gene: ENSMUSG00000034187

DomainStartEndE-ValueType
CDC48_N 2 76 6.51e-10 SMART
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.4%
  • 10x: 95.6%
  • 20x: 89.3%
Validation Efficiency 100% (50/50)
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A830018L16Rik A T 1: 11,588,818 (GRCm39) R78S probably damaging Het
Aadacl3 T C 4: 144,190,140 (GRCm39) T54A probably benign Het
Adcy8 A G 15: 64,618,780 (GRCm39) I791T probably damaging Het
Aldh1b1 A G 4: 45,803,359 (GRCm39) D299G probably damaging Het
Aoah A G 13: 21,000,764 (GRCm39) E66G probably damaging Het
Atl2 G T 17: 80,160,334 (GRCm39) H418N probably damaging Het
Atp6v1d A G 12: 78,908,214 (GRCm39) I7T possibly damaging Het
Calhm3 C T 19: 47,143,839 (GRCm39) V155M probably damaging Het
Carmil1 A T 13: 24,282,989 (GRCm39) I105K probably damaging Het
Csrp3 C A 7: 48,489,278 (GRCm39) M1I probably null Het
Dnah10 T A 5: 124,837,078 (GRCm39) probably null Het
Dnah11 T C 12: 117,897,547 (GRCm39) N3561S possibly damaging Het
Dzip3 A T 16: 48,772,180 (GRCm39) D496E probably damaging Het
Eif2ak1 T C 5: 143,820,797 (GRCm39) V246A probably benign Het
Fam171b T A 2: 83,643,313 (GRCm39) V74E probably benign Het
Gm14137 C T 2: 119,005,605 (GRCm39) R55W probably damaging Het
Gm4950 T C 18: 51,998,830 (GRCm39) I42V probably benign Het
Gpr35 T C 1: 92,910,870 (GRCm39) V194A probably damaging Het
Kdm5d C T Y: 941,011 (GRCm39) S1132F probably damaging Het
Muc4 C A 16: 32,754,529 (GRCm38) H1468N probably benign Het
Ncln A G 10: 81,332,027 (GRCm39) V24A possibly damaging Het
Nphp4 A G 4: 152,573,289 (GRCm39) K76E probably damaging Het
Nup155 A T 15: 8,187,244 (GRCm39) H1391L probably damaging Het
Or52h2 A T 7: 103,839,060 (GRCm39) L118* probably null Het
Pabpc1l G T 2: 163,879,091 (GRCm39) V313F possibly damaging Het
Pcbd2 G A 13: 55,880,881 (GRCm39) probably null Het
Rapgef6 T A 11: 54,582,525 (GRCm39) V1479D probably benign Het
Rnf43 T C 11: 87,618,301 (GRCm39) probably benign Het
Robo3 A G 9: 37,329,978 (GRCm39) W1113R probably damaging Het
Sall1 A T 8: 89,758,562 (GRCm39) V514E probably damaging Het
Sgpp1 A G 12: 75,763,056 (GRCm39) I375T probably benign Het
Strc T C 2: 121,202,604 (GRCm39) N1187S possibly damaging Het
Tbc1d17 G A 7: 44,492,895 (GRCm39) R363W probably damaging Het
Tbcd A G 11: 121,366,451 (GRCm39) Q242R probably benign Het
Tbcel A C 9: 42,362,947 (GRCm39) V50G probably damaging Het
Tead3 C T 17: 28,560,536 (GRCm39) A23T probably benign Het
Tedc2 T A 17: 24,435,291 (GRCm39) E366V probably damaging Het
Tedc2 C A 17: 24,435,292 (GRCm39) E366* probably null Het
Tlcd5 A G 9: 43,022,775 (GRCm39) V193A probably benign Het
Tmem241 G T 18: 12,217,035 (GRCm39) probably benign Het
Tmtc3 G T 10: 100,312,606 (GRCm39) T79K probably damaging Het
Utrn A G 10: 12,362,281 (GRCm39) V241A probably damaging Het
Vps8 A T 16: 21,330,307 (GRCm39) I729F probably damaging Het
Zfp407 C T 18: 84,577,898 (GRCm39) A1072T probably benign Het
Other mutations in Nsf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01161:Nsf APN 11 103,752,711 (GRCm39) splice site probably benign
IGL01377:Nsf APN 11 103,763,473 (GRCm39) missense probably damaging 0.97
IGL01994:Nsf APN 11 103,819,608 (GRCm39) missense probably damaging 0.98
IGL02141:Nsf APN 11 103,719,351 (GRCm39) missense probably benign 0.02
IGL02663:Nsf APN 11 103,821,641 (GRCm39) missense probably benign 0.04
IGL02871:Nsf APN 11 103,752,882 (GRCm39) splice site probably benign
uhaul UTSW 11 103,821,578 (GRCm39) missense possibly damaging 0.59
R0180:Nsf UTSW 11 103,821,606 (GRCm39) missense probably damaging 1.00
R0880:Nsf UTSW 11 103,804,198 (GRCm39) missense possibly damaging 0.72
R1146:Nsf UTSW 11 103,719,364 (GRCm39) missense probably damaging 1.00
R1146:Nsf UTSW 11 103,719,364 (GRCm39) missense probably damaging 1.00
R1873:Nsf UTSW 11 103,749,843 (GRCm39) missense probably damaging 1.00
R1951:Nsf UTSW 11 103,773,702 (GRCm39) nonsense probably null
R2163:Nsf UTSW 11 103,754,159 (GRCm39) missense possibly damaging 0.64
R2193:Nsf UTSW 11 103,821,578 (GRCm39) missense possibly damaging 0.59
R2194:Nsf UTSW 11 103,821,578 (GRCm39) missense possibly damaging 0.59
R2287:Nsf UTSW 11 103,821,578 (GRCm39) missense possibly damaging 0.59
R2289:Nsf UTSW 11 103,821,578 (GRCm39) missense possibly damaging 0.59
R2343:Nsf UTSW 11 103,821,578 (GRCm39) missense possibly damaging 0.59
R2345:Nsf UTSW 11 103,821,578 (GRCm39) missense possibly damaging 0.59
R2346:Nsf UTSW 11 103,821,578 (GRCm39) missense possibly damaging 0.59
R2347:Nsf UTSW 11 103,821,578 (GRCm39) missense possibly damaging 0.59
R2350:Nsf UTSW 11 103,821,578 (GRCm39) missense possibly damaging 0.59
R2405:Nsf UTSW 11 103,821,578 (GRCm39) missense possibly damaging 0.59
R2406:Nsf UTSW 11 103,821,578 (GRCm39) missense possibly damaging 0.59
R2407:Nsf UTSW 11 103,821,578 (GRCm39) missense possibly damaging 0.59
R2408:Nsf UTSW 11 103,821,578 (GRCm39) missense possibly damaging 0.59
R2409:Nsf UTSW 11 103,821,578 (GRCm39) missense possibly damaging 0.59
R2411:Nsf UTSW 11 103,821,578 (GRCm39) missense possibly damaging 0.59
R2435:Nsf UTSW 11 103,821,578 (GRCm39) missense possibly damaging 0.59
R2924:Nsf UTSW 11 103,821,578 (GRCm39) missense possibly damaging 0.59
R2925:Nsf UTSW 11 103,821,578 (GRCm39) missense possibly damaging 0.59
R2987:Nsf UTSW 11 103,749,869 (GRCm39) splice site probably null
R3177:Nsf UTSW 11 103,821,578 (GRCm39) missense possibly damaging 0.59
R3277:Nsf UTSW 11 103,821,578 (GRCm39) missense possibly damaging 0.59
R3741:Nsf UTSW 11 103,821,578 (GRCm39) missense possibly damaging 0.59
R3742:Nsf UTSW 11 103,821,578 (GRCm39) missense possibly damaging 0.59
R3845:Nsf UTSW 11 103,821,578 (GRCm39) missense possibly damaging 0.59
R4278:Nsf UTSW 11 103,821,632 (GRCm39) missense probably damaging 0.96
R4717:Nsf UTSW 11 103,714,595 (GRCm39) missense probably damaging 1.00
R4775:Nsf UTSW 11 103,763,419 (GRCm39) missense possibly damaging 0.93
R4915:Nsf UTSW 11 103,801,185 (GRCm39) unclassified probably benign
R4918:Nsf UTSW 11 103,801,185 (GRCm39) unclassified probably benign
R5090:Nsf UTSW 11 103,801,404 (GRCm39) missense probably benign 0.00
R5126:Nsf UTSW 11 103,773,618 (GRCm39) nonsense probably null
R5411:Nsf UTSW 11 103,773,637 (GRCm39) missense probably damaging 1.00
R5560:Nsf UTSW 11 103,754,081 (GRCm39) missense possibly damaging 0.47
R6344:Nsf UTSW 11 103,752,730 (GRCm39) missense probably damaging 1.00
R6596:Nsf UTSW 11 103,801,283 (GRCm39) missense probably damaging 0.98
R7155:Nsf UTSW 11 103,719,356 (GRCm39) nonsense probably null
R7272:Nsf UTSW 11 103,718,064 (GRCm39) missense probably damaging 1.00
R7769:Nsf UTSW 11 103,819,665 (GRCm39) missense probably damaging 1.00
R8323:Nsf UTSW 11 103,819,665 (GRCm39) missense probably benign 0.05
R8487:Nsf UTSW 11 103,819,584 (GRCm39) missense probably damaging 1.00
R8856:Nsf UTSW 11 103,821,568 (GRCm39) missense possibly damaging 0.69
R9253:Nsf UTSW 11 103,804,142 (GRCm39) missense probably null 1.00
R9476:Nsf UTSW 11 103,763,988 (GRCm39) missense probably damaging 1.00
R9509:Nsf UTSW 11 103,754,074 (GRCm39) missense probably benign 0.19
R9510:Nsf UTSW 11 103,763,988 (GRCm39) missense probably damaging 1.00
R9520:Nsf UTSW 11 103,804,709 (GRCm39) missense probably damaging 1.00
R9546:Nsf UTSW 11 103,801,275 (GRCm39) nonsense probably null
R9632:Nsf UTSW 11 103,714,594 (GRCm39) missense probably damaging 1.00
R9779:Nsf UTSW 11 103,719,352 (GRCm39) missense probably damaging 0.99
X0066:Nsf UTSW 11 103,714,566 (GRCm39) missense probably benign
Z1176:Nsf UTSW 11 103,801,380 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGGATCTGAATTCCAGCTCCAGC -3'
(R):5'- TGCAGTCTGCAAAGACCCTGAC -3'

Sequencing Primer
(F):5'- GCTGCCAGGTAAAATCTGATG -3'
(R):5'- CGAAAATGGGCTGGACTTTC -3'
Posted On 2014-01-15