Incidental Mutation 'R1204:Tmem214'
ID100326
Institutional Source Beutler Lab
Gene Symbol Tmem214
Ensembl Gene ENSMUSG00000038828
Gene Nametransmembrane protein 214
Synonyms
MMRRC Submission 039274-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.626) question?
Stock #R1204 (G1)
Quality Score163
Status Not validated
Chromosome5
Chromosomal Location30868012-30879180 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 30875790 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 509 (A509V)
Ref Sequence ENSEMBL: ENSMUSP00000144615 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000114716] [ENSMUST00000201203]
Predicted Effect probably damaging
Transcript: ENSMUST00000046349
AA Change: A509V

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000037484
Gene: ENSMUSG00000038828
AA Change: A509V

DomainStartEndE-ValueType
low complexity region 16 36 N/A INTRINSIC
low complexity region 84 94 N/A INTRINSIC
Pfam:DUF2359 217 683 6.9e-246 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000114716
AA Change: A464V

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000110364
Gene: ENSMUSG00000038828
AA Change: A464V

DomainStartEndE-ValueType
low complexity region 16 36 N/A INTRINSIC
low complexity region 84 94 N/A INTRINSIC
Pfam:DUF2359 172 638 8e-247 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000201203
AA Change: A509V

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000144615
Gene: ENSMUSG00000038828
AA Change: A509V

DomainStartEndE-ValueType
low complexity region 16 36 N/A INTRINSIC
low complexity region 84 94 N/A INTRINSIC
Pfam:DUF2359 217 683 6.9e-246 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201234
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202008
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202050
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202534
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202774
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202951
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.1%
  • 20x: 92.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 20 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acacb A T 5: 114,190,153 I133F probably damaging Het
Acyp1 A T 12: 85,280,092 probably null Het
Ermap T C 4: 119,188,867 K22R possibly damaging Het
Glce T C 9: 62,070,567 T12A probably damaging Het
Hao1 G A 2: 134,523,027 R227* probably null Het
Hectd4 A G 5: 121,350,485 D3613G possibly damaging Het
Hspa2 A G 12: 76,404,867 M112V probably benign Het
Knl1 A G 2: 119,071,189 I1124V probably benign Het
Lrch3 T C 16: 33,009,214 I738T probably damaging Het
Mgrn1 T G 16: 4,907,409 F44V probably damaging Het
Olfr366 A G 2: 37,219,639 Q50R probably benign Het
Otog G A 7: 46,259,911 V602M probably benign Het
Pik3r5 T G 11: 68,494,224 L652V probably benign Het
Pkdrej G A 15: 85,818,312 T1141M probably damaging Het
Sema3a T C 5: 13,523,175 probably benign Het
Syt3 A T 7: 44,392,667 I317F probably damaging Het
Tmem25 T C 9: 44,795,232 E284G probably benign Het
Trim9 T C 12: 70,346,727 N148D probably damaging Het
Vmn2r107 A G 17: 20,357,769 R447G probably benign Het
Zfp964 A T 8: 69,664,018 I423L probably benign Het
Other mutations in Tmem214
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01083:Tmem214 APN 5 30876093 missense probably benign 0.15
IGL02119:Tmem214 APN 5 30872746 missense probably benign 0.01
IGL02123:Tmem214 APN 5 30872746 missense probably benign 0.01
IGL02124:Tmem214 APN 5 30872746 missense probably benign 0.01
IGL02126:Tmem214 APN 5 30872746 missense probably benign 0.01
IGL02186:Tmem214 APN 5 30872746 missense probably benign 0.01
IGL02395:Tmem214 APN 5 30872746 missense probably benign 0.01
IGL02396:Tmem214 APN 5 30872746 missense probably benign 0.01
IGL02397:Tmem214 APN 5 30872746 missense probably benign 0.01
IGL02400:Tmem214 APN 5 30872746 missense probably benign 0.01
IGL02403:Tmem214 APN 5 30872746 missense probably benign 0.01
IGL02404:Tmem214 APN 5 30872746 missense probably benign 0.01
IGL02539:Tmem214 APN 5 30872746 missense probably benign 0.01
IGL02544:Tmem214 APN 5 30872746 missense probably benign 0.01
IGL02934:Tmem214 APN 5 30871544 missense probably benign 0.26
PIT4382001:Tmem214 UTSW 5 30871451 missense possibly damaging 0.89
R0501:Tmem214 UTSW 5 30872532 missense probably damaging 1.00
R0519:Tmem214 UTSW 5 30869668 start codon destroyed probably null 0.98
R0675:Tmem214 UTSW 5 30871825 missense possibly damaging 0.70
R1616:Tmem214 UTSW 5 30871563 nonsense probably null
R2096:Tmem214 UTSW 5 30876370 missense probably damaging 1.00
R2219:Tmem214 UTSW 5 30873631 missense possibly damaging 0.72
R5635:Tmem214 UTSW 5 30871517 missense probably damaging 1.00
R6003:Tmem214 UTSW 5 30870724 missense possibly damaging 0.52
R6744:Tmem214 UTSW 5 30874028 missense probably damaging 1.00
R7208:Tmem214 UTSW 5 30870721 missense possibly damaging 0.52
R8155:Tmem214 UTSW 5 30871792 missense possibly damaging 0.56
R8335:Tmem214 UTSW 5 30872122 missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- ACAACTCCTCTGACCTCTGAGTGC -3'
(R):5'- AGCTTCCCCTAGCCAACATGCT -3'

Sequencing Primer
(F):5'- cacagcaagtaaaagggcag -3'
(R):5'- CAAACAGCCAAAAACGGGG -3'
Posted On2014-01-15