Incidental Mutation 'R1204:Glce'
ID100344
Institutional Source Beutler Lab
Gene Symbol Glce
Ensembl Gene ENSMUSG00000032252
Gene Nameglucuronyl C5-epimerase
Synonyms1110017N23Rik, C130034A12Rik, Hsepi, heparan sulfate-glucuronic acid C5-epimerase
MMRRC Submission 039274-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1204 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location62057248-62122655 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 62070567 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 12 (T12A)
Ref Sequence ENSEMBL: ENSMUSP00000140671 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034785] [ENSMUST00000185675] [ENSMUST00000185873]
Predicted Effect possibly damaging
Transcript: ENSMUST00000034785
AA Change: T12A

PolyPhen 2 Score 0.909 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000034785
Gene: ENSMUSG00000032252
AA Change: T12A

DomainStartEndE-ValueType
transmembrane domain 12 29 N/A INTRINSIC
Pfam:C5-epim_C 417 608 1.5e-78 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000185675
AA Change: T12A

PolyPhen 2 Score 0.909 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000139949
Gene: ENSMUSG00000032252
AA Change: T12A

DomainStartEndE-ValueType
transmembrane domain 12 29 N/A INTRINSIC
Pfam:C5-epim_C 417 608 6.1e-81 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000185873
AA Change: T12A

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186514
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.1%
  • 20x: 92.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous mutant mice die immediately after birth showing severe developmental defects including renal agenesis, lung abnormalities, and skeletal malformations. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 20 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acacb A T 5: 114,190,153 I133F probably damaging Het
Acyp1 A T 12: 85,280,092 probably null Het
Ermap T C 4: 119,188,867 K22R possibly damaging Het
Hao1 G A 2: 134,523,027 R227* probably null Het
Hectd4 A G 5: 121,350,485 D3613G possibly damaging Het
Hspa2 A G 12: 76,404,867 M112V probably benign Het
Knl1 A G 2: 119,071,189 I1124V probably benign Het
Lrch3 T C 16: 33,009,214 I738T probably damaging Het
Mgrn1 T G 16: 4,907,409 F44V probably damaging Het
Olfr366 A G 2: 37,219,639 Q50R probably benign Het
Otog G A 7: 46,259,911 V602M probably benign Het
Pik3r5 T G 11: 68,494,224 L652V probably benign Het
Pkdrej G A 15: 85,818,312 T1141M probably damaging Het
Sema3a T C 5: 13,523,175 probably benign Het
Syt3 A T 7: 44,392,667 I317F probably damaging Het
Tmem214 C T 5: 30,875,790 A509V probably damaging Het
Tmem25 T C 9: 44,795,232 E284G probably benign Het
Trim9 T C 12: 70,346,727 N148D probably damaging Het
Vmn2r107 A G 17: 20,357,769 R447G probably benign Het
Zfp964 A T 8: 69,664,018 I423L probably benign Het
Other mutations in Glce
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00534:Glce APN 9 62060483 missense probably damaging 1.00
IGL02005:Glce APN 9 62060577 missense probably damaging 1.00
IGL02093:Glce APN 9 62070539 missense probably damaging 1.00
IGL02102:Glce APN 9 62070601 utr 5 prime probably benign
IGL02243:Glce APN 9 62070140 missense probably damaging 1.00
IGL03099:Glce APN 9 62060062 missense probably benign 0.18
R0004:Glce UTSW 9 62068579 missense probably damaging 1.00
R0626:Glce UTSW 9 62061000 missense probably benign
R1436:Glce UTSW 9 62070010 splice site probably null
R1475:Glce UTSW 9 62060928 missense possibly damaging 0.75
R1622:Glce UTSW 9 62070561 missense possibly damaging 0.90
R1712:Glce UTSW 9 62070575 missense probably damaging 1.00
R1740:Glce UTSW 9 62070533 missense probably damaging 0.97
R2060:Glce UTSW 9 62060946 missense possibly damaging 0.83
R4424:Glce UTSW 9 62060253 missense probably damaging 1.00
R4893:Glce UTSW 9 62068495 missense probably benign
R5350:Glce UTSW 9 62060305 nonsense probably null
R5569:Glce UTSW 9 62070203 missense probably benign 0.35
R5666:Glce UTSW 9 62060511 missense probably damaging 1.00
R5670:Glce UTSW 9 62060511 missense probably damaging 1.00
R5743:Glce UTSW 9 62070540 missense probably damaging 1.00
R5909:Glce UTSW 9 62060144 missense probably damaging 1.00
R7091:Glce UTSW 9 62060588 missense probably damaging 1.00
R7139:Glce UTSW 9 62070434 nonsense probably null
R7549:Glce UTSW 9 62060993 missense probably damaging 1.00
R7854:Glce UTSW 9 62070491 missense probably benign 0.01
R7965:Glce UTSW 9 62060946 missense probably damaging 1.00
R8022:Glce UTSW 9 62060591 missense probably benign 0.08
R8264:Glce UTSW 9 62060430 missense probably benign
R8743:Glce UTSW 9 62060821 missense probably benign 0.01
X0057:Glce UTSW 9 62060370 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTCTCGGACTTCCACATTGTAGCC -3'
(R):5'- TGTGCTGAGCAGTTTGCCTCTTATC -3'

Sequencing Primer
(F):5'- ATCGATCATAGCCGTCATACTGG -3'
(R):5'- CTTCACCTATGCTGAAAAGTTTGAG -3'
Posted On2014-01-15