Incidental Mutation 'R1204:Acyp1'
ID100354
Institutional Source Beutler Lab
Gene Symbol Acyp1
Ensembl Gene ENSMUSG00000008822
Gene Nameacylphosphatase 1, erythrocyte (common) type
Synonyms
MMRRC Submission 039274-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.488) question?
Stock #R1204 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location85272398-85288438 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to T at 85280092 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000112609 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000008966] [ENSMUST00000065913] [ENSMUST00000117138] [ENSMUST00000121930]
Predicted Effect probably null
Transcript: ENSMUST00000008966
SMART Domains Protein: ENSMUSP00000008966
Gene: ENSMUSG00000008822

DomainStartEndE-ValueType
Pfam:Acylphosphatase 1 98 6e-26 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000065913
SMART Domains Protein: ENSMUSP00000070555
Gene: ENSMUSG00000008822

DomainStartEndE-ValueType
Pfam:Acylphosphatase 1 35 5.2e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000117138
SMART Domains Protein: ENSMUSP00000113161
Gene: ENSMUSG00000008822

DomainStartEndE-ValueType
Pfam:Acylphosphatase 1 98 6e-26 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000121930
SMART Domains Protein: ENSMUSP00000112609
Gene: ENSMUSG00000008822

DomainStartEndE-ValueType
Pfam:Acylphosphatase 64 156 4.5e-25 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.1%
  • 20x: 92.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the acylphosphatase family. The encoded protein is a small cytosolic enzyme that catalyzes the hydrolysis of the carboxyl-phosphate bond of acylphosphates. Two isoenzymes have been isolated and described based on their tissue localization: erythrocyte (common) type acylphosphatase encoded by this gene, and muscle type acylphosphatase. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2014]
Allele List at MGI
Other mutations in this stock
Total: 20 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acacb A T 5: 114,190,153 I133F probably damaging Het
Ermap T C 4: 119,188,867 K22R possibly damaging Het
Glce T C 9: 62,070,567 T12A probably damaging Het
Hao1 G A 2: 134,523,027 R227* probably null Het
Hectd4 A G 5: 121,350,485 D3613G possibly damaging Het
Hspa2 A G 12: 76,404,867 M112V probably benign Het
Knl1 A G 2: 119,071,189 I1124V probably benign Het
Lrch3 T C 16: 33,009,214 I738T probably damaging Het
Mgrn1 T G 16: 4,907,409 F44V probably damaging Het
Olfr366 A G 2: 37,219,639 Q50R probably benign Het
Otog G A 7: 46,259,911 V602M probably benign Het
Pik3r5 T G 11: 68,494,224 L652V probably benign Het
Pkdrej G A 15: 85,818,312 T1141M probably damaging Het
Sema3a T C 5: 13,523,175 probably benign Het
Syt3 A T 7: 44,392,667 I317F probably damaging Het
Tmem214 C T 5: 30,875,790 A509V probably damaging Het
Tmem25 T C 9: 44,795,232 E284G probably benign Het
Trim9 T C 12: 70,346,727 N148D probably damaging Het
Vmn2r107 A G 17: 20,357,769 R447G probably benign Het
Zfp964 A T 8: 69,664,018 I423L probably benign Het
Other mutations in Acyp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1898:Acyp1 UTSW 12 85288340 missense probably benign 0.00
R4683:Acyp1 UTSW 12 85278943 intron probably benign
R5336:Acyp1 UTSW 12 85280011 missense probably damaging 1.00
R5392:Acyp1 UTSW 12 85278985 intron probably benign
R6747:Acyp1 UTSW 12 85278905 missense probably null
R7075:Acyp1 UTSW 12 85279008 missense unknown
R7746:Acyp1 UTSW 12 85279058 missense unknown
R7794:Acyp1 UTSW 12 85288279 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TTGGTGACAGTACAACAGGGTGCG -3'
(R):5'- TCGGATCATCCAAGTGTCAGTGGAG -3'

Sequencing Primer
(F):5'- CTAGCGGTATTCTCCGTCAGG -3'
(R):5'- ATGGATGGCGGCTTCAG -3'
Posted On2014-01-15