Incidental Mutation 'R1204:Mgrn1'
ID100358
Institutional Source Beutler Lab
Gene Symbol Mgrn1
Ensembl Gene ENSMUSG00000022517
Gene Namemahogunin, ring finger 1
Synonyms2610042J20Rik, nc
MMRRC Submission 039274-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1204 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location4886249-4938296 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 4907409 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Valine at position 44 (F44V)
Ref Sequence ENSEMBL: ENSMUSP00000155425 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023159] [ENSMUST00000070658] [ENSMUST00000229038] [ENSMUST00000230990]
Predicted Effect probably damaging
Transcript: ENSMUST00000023159
AA Change: F44V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000023159
Gene: ENSMUSG00000022517
AA Change: F44V

DomainStartEndE-ValueType
low complexity region 205 216 N/A INTRINSIC
low complexity region 268 278 N/A INTRINSIC
RING 279 317 4.58e-4 SMART
low complexity region 349 360 N/A INTRINSIC
low complexity region 443 454 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000070658
AA Change: F44V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000068314
Gene: ENSMUSG00000022517
AA Change: F44V

DomainStartEndE-ValueType
low complexity region 204 215 N/A INTRINSIC
low complexity region 267 277 N/A INTRINSIC
RING 278 316 4.58e-4 SMART
low complexity region 348 359 N/A INTRINSIC
low complexity region 442 453 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000229038
AA Change: F45V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000230990
AA Change: F44V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.1%
  • 20x: 92.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mahogunin (MGRN1) is a C3HC4 RING-containing protein with E3 ubiquitin ligase activity in vitro.[supplied by OMIM, Apr 2004]
PHENOTYPE: Homozygotes for mutant alleles exhibit darkening of agouti hair and suppression of the obesity associated with certain agouti mutations. Homozygotes for an induced null mutation also have curly whiskers and develop a progressive spongiform neuropathology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 20 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acacb A T 5: 114,190,153 I133F probably damaging Het
Acyp1 A T 12: 85,280,092 probably null Het
Ermap T C 4: 119,188,867 K22R possibly damaging Het
Glce T C 9: 62,070,567 T12A probably damaging Het
Hao1 G A 2: 134,523,027 R227* probably null Het
Hectd4 A G 5: 121,350,485 D3613G possibly damaging Het
Hspa2 A G 12: 76,404,867 M112V probably benign Het
Knl1 A G 2: 119,071,189 I1124V probably benign Het
Lrch3 T C 16: 33,009,214 I738T probably damaging Het
Olfr366 A G 2: 37,219,639 Q50R probably benign Het
Otog G A 7: 46,259,911 V602M probably benign Het
Pik3r5 T G 11: 68,494,224 L652V probably benign Het
Pkdrej G A 15: 85,818,312 T1141M probably damaging Het
Sema3a T C 5: 13,523,175 probably benign Het
Syt3 A T 7: 44,392,667 I317F probably damaging Het
Tmem214 C T 5: 30,875,790 A509V probably damaging Het
Tmem25 T C 9: 44,795,232 E284G probably benign Het
Trim9 T C 12: 70,346,727 N148D probably damaging Het
Vmn2r107 A G 17: 20,357,769 R447G probably benign Het
Zfp964 A T 8: 69,664,018 I423L probably benign Het
Other mutations in Mgrn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01108:Mgrn1 APN 16 4916155 critical splice donor site probably null
IGL02175:Mgrn1 APN 16 4920368 missense probably benign 0.02
IGL02382:Mgrn1 APN 16 4922618 missense probably damaging 0.97
R1515:Mgrn1 UTSW 16 4915780 missense probably benign 0.11
R1625:Mgrn1 UTSW 16 4910763 missense probably damaging 1.00
R2875:Mgrn1 UTSW 16 4907416 missense possibly damaging 0.85
R4928:Mgrn1 UTSW 16 4927862 missense probably benign 0.29
R4955:Mgrn1 UTSW 16 4934219 missense probably benign 0.00
R6085:Mgrn1 UTSW 16 4920376 missense probably benign 0.01
R6189:Mgrn1 UTSW 16 4910810 critical splice donor site probably null
R7095:Mgrn1 UTSW 16 4927664 splice site probably null
R7293:Mgrn1 UTSW 16 4932220 missense probably benign 0.01
R7610:Mgrn1 UTSW 16 4934233 makesense probably null
R8187:Mgrn1 UTSW 16 4920365 missense probably benign 0.02
R8376:Mgrn1 UTSW 16 4915766 missense probably damaging 1.00
Z1177:Mgrn1 UTSW 16 4922724 missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- AGGCCAATGGTGTGCAGCAAAC -3'
(R):5'- TAATGGCTGCTCTGTCCCTCAGTG -3'

Sequencing Primer
(F):5'- TGCAGCAAACTGGCTGAG -3'
(R):5'- AGTGACCCAGTGCTCACTC -3'
Posted On2014-01-15