Incidental Mutation 'R1205:Tas2r134'
ID100380
Institutional Source Beutler Lab
Gene Symbol Tas2r134
Ensembl Gene ENSMUSG00000056115
Gene Nametaste receptor, type 2, member 134
SynonymsT2R134, Tas2r34
MMRRC Submission 039275-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.053) question?
Stock #R1205 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location51627511-51628408 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 51627986 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 159 (Y159C)
Ref Sequence ENSEMBL: ENSMUSP00000064657 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070028]
Predicted Effect probably benign
Transcript: ENSMUST00000070028
AA Change: Y159C

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000064657
Gene: ENSMUSG00000056115
AA Change: Y159C

DomainStartEndE-ValueType
Pfam:TAS2R 1 291 1.4e-75 PFAM
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 90.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrg6 T A 10: 14,434,339 N774I probably damaging Het
BC005561 T C 5: 104,520,213 L867S probably benign Het
Bpifc T A 10: 85,981,304 D230V probably damaging Het
Chrna2 C T 14: 66,143,363 A27V probably benign Het
Duox1 C T 2: 122,327,925 Q630* probably null Het
Dzip3 C T 16: 48,951,681 G542R probably damaging Het
Epha3 ATGAACTGCT AT 16: 63,598,248 probably null Het
Fam208a A T 14: 27,461,318 D578V probably damaging Het
Fnip1 G T 11: 54,502,306 V523L possibly damaging Het
Hc T A 2: 35,003,524 D1225V possibly damaging Het
Hnrnpu C T 1: 178,332,169 probably benign Het
Ift172 C T 5: 31,285,792 V125I probably benign Het
Kcnip2 T A 19: 45,794,983 Q93L probably null Het
Kif27 A T 13: 58,344,205 H373Q probably benign Het
Kl T C 5: 150,980,688 S302P probably damaging Het
Lyst G A 13: 13,680,202 V2386I probably benign Het
Map4k4 G A 1: 40,003,844 A128T probably damaging Het
March6 A C 15: 31,469,673 M717R probably benign Het
Morc2b A G 17: 33,135,934 Y955H probably damaging Het
Myo7b A G 18: 31,994,342 S636P probably damaging Het
Neb T A 2: 52,222,984 D4266V probably damaging Het
Nynrin G A 14: 55,854,189 probably benign Het
Olfr1212 A T 2: 88,958,588 I41L probably benign Het
Olfr1457 T C 19: 13,095,535 I38V probably benign Het
Olfr347 G A 2: 36,734,755 V145I probably benign Het
Pcdh9 A G 14: 93,886,065 S890P probably benign Het
Pcnx G T 12: 81,956,243 D1052Y probably damaging Het
Pibf1 G A 14: 99,101,203 E52K probably damaging Het
Siglec1 T G 2: 131,080,464 S564R possibly damaging Het
Sin3a T A 9: 57,119,175 V1125E probably damaging Het
Slco4c1 G T 1: 96,867,888 D148E probably damaging Het
Spag6l A T 16: 16,787,307 L127Q probably damaging Het
Syne4 C A 7: 30,315,336 T68N probably damaging Het
Tmem132a C A 19: 10,859,084 R694L probably benign Het
Ttc28 C T 5: 111,285,769 P2192L probably benign Het
Ttc34 T G 4: 154,862,214 V857G probably benign Het
Ugt1a7c A T 1: 88,095,956 H279L probably benign Het
Vmn1r32 G A 6: 66,553,555 T79I probably benign Het
Vps13a A T 19: 16,640,541 V2960D probably damaging Het
Wee2 G T 6: 40,443,941 probably benign Het
Other mutations in Tas2r134
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00562:Tas2r134 APN 2 51628088 missense possibly damaging 0.90
IGL00563:Tas2r134 APN 2 51628088 missense possibly damaging 0.90
IGL01121:Tas2r134 APN 2 51627989 missense probably damaging 1.00
IGL01122:Tas2r134 APN 2 51627659 missense probably damaging 1.00
IGL01128:Tas2r134 APN 2 51627659 missense probably damaging 1.00
IGL01132:Tas2r134 APN 2 51627659 missense probably damaging 1.00
IGL01312:Tas2r134 APN 2 51628235 missense probably damaging 1.00
IGL01419:Tas2r134 APN 2 51627747 nonsense probably null
IGL01774:Tas2r134 APN 2 51628148 missense probably benign 0.07
IGL02735:Tas2r134 APN 2 51627827 missense probably damaging 1.00
R0799:Tas2r134 UTSW 2 51628373 missense probably benign 0.00
R2267:Tas2r134 UTSW 2 51628237 missense probably benign 0.01
R3736:Tas2r134 UTSW 2 51627774 missense probably damaging 1.00
R5254:Tas2r134 UTSW 2 51627547 missense probably benign 0.39
R5752:Tas2r134 UTSW 2 51627868 missense probably damaging 1.00
R6162:Tas2r134 UTSW 2 51627559 missense probably damaging 1.00
R6940:Tas2r134 UTSW 2 51628136 missense probably benign 0.00
R6954:Tas2r134 UTSW 2 51627770 missense probably benign 0.00
R6996:Tas2r134 UTSW 2 51627589 missense probably benign 0.00
R7206:Tas2r134 UTSW 2 51628108 missense probably benign 0.02
R7303:Tas2r134 UTSW 2 51628133 missense probably benign 0.01
R7348:Tas2r134 UTSW 2 51628402 missense possibly damaging 0.92
R7479:Tas2r134 UTSW 2 51627529 missense not run
R7575:Tas2r134 UTSW 2 51628154 missense probably damaging 1.00
R7686:Tas2r134 UTSW 2 51628243 missense possibly damaging 0.54
Predicted Primers PCR Primer
(F):5'- TTCTGTCTGCATGGAATAGCCGTC -3'
(R):5'- GGGACTTCAGAGCCATAATGTGAGC -3'

Sequencing Primer
(F):5'- TCTGGGACTTCACCAACACTG -3'
(R):5'- CCTGGGTGCTGTAATCATGAG -3'
Posted On2014-01-15