Incidental Mutation 'R1205:Ttc34'
ID100394
Institutional Source Beutler Lab
Gene Symbol Ttc34
Ensembl Gene ENSMUSG00000046637
Gene Nametetratricopeptide repeat domain 34
Synonyms
MMRRC Submission 039275-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.100) question?
Stock #R1205 (G1)
Quality Score192
Status Not validated
Chromosome4
Chromosomal Location154837459-154867127 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 154862214 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glycine at position 857 (V857G)
Ref Sequence ENSEMBL: ENSMUSP00000146409 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050220] [ENSMUST00000207854]
Predicted Effect probably benign
Transcript: ENSMUST00000050220
AA Change: V348G

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000051782
Gene: ENSMUSG00000046637
AA Change: V348G

DomainStartEndE-ValueType
Blast:TPR 38 68 4e-6 BLAST
low complexity region 69 85 N/A INTRINSIC
TPR 166 199 2.66e0 SMART
TPR 200 233 4.45e-2 SMART
TPR 294 327 9e1 SMART
Blast:TPR 328 361 2e-7 BLAST
TPR 412 445 8.77e1 SMART
TPR 452 485 1.78e-1 SMART
Blast:TPR 500 533 9e-8 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137684
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138795
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151696
Predicted Effect probably benign
Transcript: ENSMUST00000207854
AA Change: V857G

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 90.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrg6 T A 10: 14,434,339 N774I probably damaging Het
BC005561 T C 5: 104,520,213 L867S probably benign Het
Bpifc T A 10: 85,981,304 D230V probably damaging Het
Chrna2 C T 14: 66,143,363 A27V probably benign Het
Duox1 C T 2: 122,327,925 Q630* probably null Het
Dzip3 C T 16: 48,951,681 G542R probably damaging Het
Epha3 ATGAACTGCT AT 16: 63,598,248 probably null Het
Fam208a A T 14: 27,461,318 D578V probably damaging Het
Fnip1 G T 11: 54,502,306 V523L possibly damaging Het
Hc T A 2: 35,003,524 D1225V possibly damaging Het
Hnrnpu C T 1: 178,332,169 probably benign Het
Ift172 C T 5: 31,285,792 V125I probably benign Het
Kcnip2 T A 19: 45,794,983 Q93L probably null Het
Kif27 A T 13: 58,344,205 H373Q probably benign Het
Kl T C 5: 150,980,688 S302P probably damaging Het
Lyst G A 13: 13,680,202 V2386I probably benign Het
Map4k4 G A 1: 40,003,844 A128T probably damaging Het
March6 A C 15: 31,469,673 M717R probably benign Het
Morc2b A G 17: 33,135,934 Y955H probably damaging Het
Myo7b A G 18: 31,994,342 S636P probably damaging Het
Neb T A 2: 52,222,984 D4266V probably damaging Het
Nynrin G A 14: 55,854,189 probably benign Het
Olfr1212 A T 2: 88,958,588 I41L probably benign Het
Olfr1457 T C 19: 13,095,535 I38V probably benign Het
Olfr347 G A 2: 36,734,755 V145I probably benign Het
Pcdh9 A G 14: 93,886,065 S890P probably benign Het
Pcnx G T 12: 81,956,243 D1052Y probably damaging Het
Pibf1 G A 14: 99,101,203 E52K probably damaging Het
Siglec1 T G 2: 131,080,464 S564R possibly damaging Het
Sin3a T A 9: 57,119,175 V1125E probably damaging Het
Slco4c1 G T 1: 96,867,888 D148E probably damaging Het
Spag6l A T 16: 16,787,307 L127Q probably damaging Het
Syne4 C A 7: 30,315,336 T68N probably damaging Het
Tas2r134 A G 2: 51,627,986 Y159C probably benign Het
Tmem132a C A 19: 10,859,084 R694L probably benign Het
Ttc28 C T 5: 111,285,769 P2192L probably benign Het
Ugt1a7c A T 1: 88,095,956 H279L probably benign Het
Vmn1r32 G A 6: 66,553,555 T79I probably benign Het
Vps13a A T 19: 16,640,541 V2960D probably damaging Het
Wee2 G T 6: 40,443,941 probably benign Het
Other mutations in Ttc34
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03000:Ttc34 APN 4 154865431 missense probably damaging 1.00
IGL03034:Ttc34 APN 4 154861183 missense probably damaging 1.00
IGL03139:Ttc34 APN 4 154861270 missense probably benign 0.04
R1775:Ttc34 UTSW 4 154862214 missense probably benign 0.00
R1935:Ttc34 UTSW 4 154865682 missense possibly damaging 0.80
R1936:Ttc34 UTSW 4 154865682 missense possibly damaging 0.80
R1937:Ttc34 UTSW 4 154865682 missense possibly damaging 0.80
R1939:Ttc34 UTSW 4 154865682 missense possibly damaging 0.80
R1940:Ttc34 UTSW 4 154865682 missense possibly damaging 0.80
R3701:Ttc34 UTSW 4 154865482 missense probably damaging 1.00
R5181:Ttc34 UTSW 4 154862246 missense probably benign 0.00
R5845:Ttc34 UTSW 4 154865472 missense probably benign 0.08
R6603:Ttc34 UTSW 4 154839305 missense probably benign 0.34
R6930:Ttc34 UTSW 4 154839086 missense probably damaging 0.99
R7209:Ttc34 UTSW 4 154839128 missense probably damaging 1.00
R7548:Ttc34 UTSW 4 154856359 missense probably damaging 1.00
R7640:Ttc34 UTSW 4 154861384 missense probably benign
R7727:Ttc34 UTSW 4 154839274 missense possibly damaging 0.81
R7856:Ttc34 UTSW 4 154861286 missense probably benign
R7893:Ttc34 UTSW 4 154861300 missense probably benign 0.05
R7894:Ttc34 UTSW 4 154859383 missense probably damaging 1.00
R7939:Ttc34 UTSW 4 154861286 missense probably benign
R7976:Ttc34 UTSW 4 154861300 missense probably benign 0.05
R7977:Ttc34 UTSW 4 154859383 missense probably damaging 1.00
Z1177:Ttc34 UTSW 4 154865397 missense possibly damaging 0.73
Predicted Primers PCR Primer
(F):5'- TGGACTCCACCCAAGACAGAGTAG -3'
(R):5'- TGTACCAGGACAAGGTTCCTCAGC -3'

Sequencing Primer
(F):5'- GTCATCAGAGTAGCTCCCTG -3'
(R):5'- catcaagaagggaagggcag -3'
Posted On2014-01-15