Incidental Mutation 'R1205:Bpifc'
ID100422
Institutional Source Beutler Lab
Gene Symbol Bpifc
Ensembl Gene ENSMUSG00000050108
Gene NameBPI fold containing family C
SynonymsBpil2
MMRRC Submission 039275-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.106) question?
Stock #R1205 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location85959340-86011895 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 85981304 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 230 (D230V)
Ref Sequence ENSEMBL: ENSMUSP00000063107 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061699]
Predicted Effect probably damaging
Transcript: ENSMUST00000061699
AA Change: D230V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000063107
Gene: ENSMUSG00000050108
AA Change: D230V

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
BPI1 33 257 8.89e-23 SMART
BPI2 272 474 2.29e-25 SMART
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 90.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrg6 T A 10: 14,434,339 N774I probably damaging Het
BC005561 T C 5: 104,520,213 L867S probably benign Het
Chrna2 C T 14: 66,143,363 A27V probably benign Het
Duox1 C T 2: 122,327,925 Q630* probably null Het
Dzip3 C T 16: 48,951,681 G542R probably damaging Het
Epha3 ATGAACTGCT AT 16: 63,598,248 probably null Het
Fam208a A T 14: 27,461,318 D578V probably damaging Het
Fnip1 G T 11: 54,502,306 V523L possibly damaging Het
Hc T A 2: 35,003,524 D1225V possibly damaging Het
Hnrnpu C T 1: 178,332,169 probably benign Het
Ift172 C T 5: 31,285,792 V125I probably benign Het
Kcnip2 T A 19: 45,794,983 Q93L probably null Het
Kif27 A T 13: 58,344,205 H373Q probably benign Het
Kl T C 5: 150,980,688 S302P probably damaging Het
Lyst G A 13: 13,680,202 V2386I probably benign Het
Map4k4 G A 1: 40,003,844 A128T probably damaging Het
March6 A C 15: 31,469,673 M717R probably benign Het
Morc2b A G 17: 33,135,934 Y955H probably damaging Het
Myo7b A G 18: 31,994,342 S636P probably damaging Het
Neb T A 2: 52,222,984 D4266V probably damaging Het
Nynrin G A 14: 55,854,189 probably benign Het
Olfr1212 A T 2: 88,958,588 I41L probably benign Het
Olfr1457 T C 19: 13,095,535 I38V probably benign Het
Olfr347 G A 2: 36,734,755 V145I probably benign Het
Pcdh9 A G 14: 93,886,065 S890P probably benign Het
Pcnx G T 12: 81,956,243 D1052Y probably damaging Het
Pibf1 G A 14: 99,101,203 E52K probably damaging Het
Siglec1 T G 2: 131,080,464 S564R possibly damaging Het
Sin3a T A 9: 57,119,175 V1125E probably damaging Het
Slco4c1 G T 1: 96,867,888 D148E probably damaging Het
Spag6l A T 16: 16,787,307 L127Q probably damaging Het
Syne4 C A 7: 30,315,336 T68N probably damaging Het
Tas2r134 A G 2: 51,627,986 Y159C probably benign Het
Tmem132a C A 19: 10,859,084 R694L probably benign Het
Ttc28 C T 5: 111,285,769 P2192L probably benign Het
Ttc34 T G 4: 154,862,214 V857G probably benign Het
Ugt1a7c A T 1: 88,095,956 H279L probably benign Het
Vmn1r32 G A 6: 66,553,555 T79I probably benign Het
Vps13a A T 19: 16,640,541 V2960D probably damaging Het
Wee2 G T 6: 40,443,941 probably benign Het
Other mutations in Bpifc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00264:Bpifc APN 10 85960528 missense possibly damaging 0.85
IGL01474:Bpifc APN 10 86000639 start codon destroyed probably damaging 0.98
IGL02437:Bpifc APN 10 85988731 missense probably damaging 1.00
R0689:Bpifc UTSW 10 85960547 splice site probably benign
R1524:Bpifc UTSW 10 85977735 missense probably benign 0.01
R2033:Bpifc UTSW 10 86000632 missense possibly damaging 0.88
R3103:Bpifc UTSW 10 85993422 missense probably damaging 1.00
R3609:Bpifc UTSW 10 86000638 start codon destroyed probably null 1.00
R3874:Bpifc UTSW 10 85991254 missense probably benign
R4728:Bpifc UTSW 10 85991199 missense possibly damaging 0.50
R5079:Bpifc UTSW 10 85981304 missense probably damaging 1.00
R5193:Bpifc UTSW 10 86000633 missense probably benign 0.01
R6280:Bpifc UTSW 10 85977712 missense probably benign 0.02
R6291:Bpifc UTSW 10 85976258 missense probably damaging 1.00
R6945:Bpifc UTSW 10 85979214 missense probably benign 0.00
R7288:Bpifc UTSW 10 85988721 missense possibly damaging 0.95
R7310:Bpifc UTSW 10 85963027 missense probably damaging 1.00
R7463:Bpifc UTSW 10 85979334 missense probably benign 0.00
R7807:Bpifc UTSW 10 85976250 missense possibly damaging 0.80
R8004:Bpifc UTSW 10 85979284 missense probably benign
Z1176:Bpifc UTSW 10 85965228 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AACATGCGGCAGGTGCTATAGG -3'
(R):5'- CCCCGAGAGTTGAGAACATTTGAACC -3'

Sequencing Primer
(F):5'- GGTGCTATAGGAAATGAAATTGCTTG -3'
(R):5'- GTTGAGAACATTTGAACCATTTACC -3'
Posted On2014-01-15