Incidental Mutation 'R1205:Dzip3'
ID100449
Institutional Source Beutler Lab
Gene Symbol Dzip3
Ensembl Gene ENSMUSG00000064061
Gene NameDAZ interacting protein 3, zinc finger
Synonyms2A-HUB, 6430549P11Rik, 2310047C04Rik
MMRRC Submission 039275-MU
Accession Numbers

Genbank: NM_001110017.1, NM_027341.2; Ensembl: ENSMUST00000121869

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1205 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location48924232-48994165 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 48951681 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Arginine at position 542 (G542R)
Ref Sequence ENSEMBL: ENSMUSP00000113344 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000114516] [ENSMUST00000121869]
Predicted Effect probably benign
Transcript: ENSMUST00000114516
SMART Domains Protein: ENSMUSP00000110161
Gene: ENSMUSG00000064061

DomainStartEndE-ValueType
low complexity region 451 472 N/A INTRINSIC
coiled coil region 548 568 N/A INTRINSIC
coiled coil region 599 650 N/A INTRINSIC
low complexity region 743 754 N/A INTRINSIC
low complexity region 883 891 N/A INTRINSIC
RING 938 977 2.09e-7 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000121869
AA Change: G542R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113344
Gene: ENSMUSG00000064061
AA Change: G542R

DomainStartEndE-ValueType
low complexity region 657 678 N/A INTRINSIC
coiled coil region 754 774 N/A INTRINSIC
coiled coil region 805 856 N/A INTRINSIC
low complexity region 949 960 N/A INTRINSIC
low complexity region 1089 1097 N/A INTRINSIC
RING 1144 1183 2.09e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133377
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 90.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for an ENU-indcued allele exhibit embryonic lethality. [provided by MGI curators]
Allele List at MGI

All alleles(23) : Gene trapped(23)

Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrg6 T A 10: 14,434,339 N774I probably damaging Het
BC005561 T C 5: 104,520,213 L867S probably benign Het
Bpifc T A 10: 85,981,304 D230V probably damaging Het
Chrna2 C T 14: 66,143,363 A27V probably benign Het
Duox1 C T 2: 122,327,925 Q630* probably null Het
Epha3 ATGAACTGCT AT 16: 63,598,248 probably null Het
Fam208a A T 14: 27,461,318 D578V probably damaging Het
Fnip1 G T 11: 54,502,306 V523L possibly damaging Het
Hc T A 2: 35,003,524 D1225V possibly damaging Het
Hnrnpu C T 1: 178,332,169 probably benign Het
Ift172 C T 5: 31,285,792 V125I probably benign Het
Kcnip2 T A 19: 45,794,983 Q93L probably null Het
Kif27 A T 13: 58,344,205 H373Q probably benign Het
Kl T C 5: 150,980,688 S302P probably damaging Het
Lyst G A 13: 13,680,202 V2386I probably benign Het
Map4k4 G A 1: 40,003,844 A128T probably damaging Het
March6 A C 15: 31,469,673 M717R probably benign Het
Morc2b A G 17: 33,135,934 Y955H probably damaging Het
Myo7b A G 18: 31,994,342 S636P probably damaging Het
Neb T A 2: 52,222,984 D4266V probably damaging Het
Nynrin G A 14: 55,854,189 probably benign Het
Olfr1212 A T 2: 88,958,588 I41L probably benign Het
Olfr1457 T C 19: 13,095,535 I38V probably benign Het
Olfr347 G A 2: 36,734,755 V145I probably benign Het
Pcdh9 A G 14: 93,886,065 S890P probably benign Het
Pcnx G T 12: 81,956,243 D1052Y probably damaging Het
Pibf1 G A 14: 99,101,203 E52K probably damaging Het
Siglec1 T G 2: 131,080,464 S564R possibly damaging Het
Sin3a T A 9: 57,119,175 V1125E probably damaging Het
Slco4c1 G T 1: 96,867,888 D148E probably damaging Het
Spag6l A T 16: 16,787,307 L127Q probably damaging Het
Syne4 C A 7: 30,315,336 T68N probably damaging Het
Tas2r134 A G 2: 51,627,986 Y159C probably benign Het
Tmem132a C A 19: 10,859,084 R694L probably benign Het
Ttc28 C T 5: 111,285,769 P2192L probably benign Het
Ttc34 T G 4: 154,862,214 V857G probably benign Het
Ugt1a7c A T 1: 88,095,956 H279L probably benign Het
Vmn1r32 G A 6: 66,553,555 T79I probably benign Het
Vps13a A T 19: 16,640,541 V2960D probably damaging Het
Wee2 G T 6: 40,443,941 probably benign Het
Other mutations in Dzip3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00825:Dzip3 APN 16 48928415 missense probably damaging 1.00
IGL00931:Dzip3 APN 16 48935497 critical splice donor site probably null
IGL01109:Dzip3 APN 16 48929674 missense probably benign 0.27
IGL01121:Dzip3 APN 16 48944881 missense probably benign 0.10
IGL01328:Dzip3 APN 16 48972258 missense probably damaging 1.00
IGL01729:Dzip3 APN 16 48928363 missense possibly damaging 0.78
IGL02044:Dzip3 APN 16 48948427 missense possibly damaging 0.90
IGL02051:Dzip3 APN 16 48972254 missense probably benign 0.01
IGL02115:Dzip3 APN 16 48948485 missense probably benign 0.00
IGL02125:Dzip3 APN 16 48927596 missense probably damaging 1.00
IGL02136:Dzip3 APN 16 48927582 missense possibly damaging 0.94
IGL02244:Dzip3 APN 16 48980988 missense probably benign 0.01
IGL02253:Dzip3 APN 16 48944924 missense probably benign 0.34
IGL02412:Dzip3 APN 16 48958457 missense probably benign 0.00
IGL02452:Dzip3 APN 16 48938537 splice site probably benign
IGL02481:Dzip3 APN 16 48975551 splice site probably benign
IGL02499:Dzip3 APN 16 48933850 missense probably damaging 1.00
IGL02511:Dzip3 APN 16 48936980 missense possibly damaging 0.75
IGL02519:Dzip3 APN 16 48928396 missense probably damaging 1.00
IGL02610:Dzip3 APN 16 48951653 missense probably damaging 1.00
IGL03129:Dzip3 APN 16 48942083 missense possibly damaging 0.51
IGL03342:Dzip3 APN 16 48929623 missense probably damaging 0.98
IGL03493:Dzip3 APN 16 48951696 missense probably benign 0.32
dazwick UTSW 16 48958465 missense possibly damaging 0.90
1mM(1):Dzip3 UTSW 16 48951557 missense probably damaging 1.00
PIT4651001:Dzip3 UTSW 16 48944878 missense probably benign
R0313:Dzip3 UTSW 16 48937061 missense probably damaging 0.99
R0483:Dzip3 UTSW 16 48947713 missense possibly damaging 0.94
R0504:Dzip3 UTSW 16 48959643 splice site probably benign
R0744:Dzip3 UTSW 16 48959675 missense probably damaging 1.00
R0800:Dzip3 UTSW 16 48953808 splice site probably benign
R0927:Dzip3 UTSW 16 48975477 missense probably damaging 0.99
R0931:Dzip3 UTSW 16 48951558 missense probably damaging 1.00
R1170:Dzip3 UTSW 16 48961208 missense probably damaging 1.00
R1203:Dzip3 UTSW 16 48951817 missense probably damaging 1.00
R1442:Dzip3 UTSW 16 48945622 missense probably benign 0.19
R1526:Dzip3 UTSW 16 48937006 missense probably damaging 1.00
R1560:Dzip3 UTSW 16 48951540 splice site probably null
R1585:Dzip3 UTSW 16 48977878 splice site probably benign
R1682:Dzip3 UTSW 16 48958417 critical splice donor site probably null
R1957:Dzip3 UTSW 16 48927593 missense probably damaging 1.00
R2472:Dzip3 UTSW 16 48953787 missense possibly damaging 0.85
R2571:Dzip3 UTSW 16 48972218 splice site probably null
R3040:Dzip3 UTSW 16 48928324 missense probably damaging 1.00
R3081:Dzip3 UTSW 16 48927558 missense probably damaging 1.00
R3615:Dzip3 UTSW 16 48937063 missense probably damaging 1.00
R3616:Dzip3 UTSW 16 48937063 missense probably damaging 1.00
R3786:Dzip3 UTSW 16 48975543 missense probably benign 0.08
R3851:Dzip3 UTSW 16 48950013 missense possibly damaging 0.94
R4097:Dzip3 UTSW 16 48958489 nonsense probably null
R4371:Dzip3 UTSW 16 48943455 critical splice donor site probably null
R4612:Dzip3 UTSW 16 48952040 nonsense probably null
R4671:Dzip3 UTSW 16 48979590 nonsense probably null
R4695:Dzip3 UTSW 16 48951561 missense probably damaging 1.00
R4696:Dzip3 UTSW 16 48925969 unclassified probably benign
R4769:Dzip3 UTSW 16 48938474 missense probably damaging 0.97
R5063:Dzip3 UTSW 16 48953754 nonsense probably null
R5321:Dzip3 UTSW 16 48957675 missense possibly damaging 0.95
R5764:Dzip3 UTSW 16 48927361 intron probably benign
R6020:Dzip3 UTSW 16 48951842 missense probably damaging 1.00
R6218:Dzip3 UTSW 16 48958465 missense possibly damaging 0.90
R6300:Dzip3 UTSW 16 48951807 missense probably damaging 1.00
R6365:Dzip3 UTSW 16 48931273 missense probably damaging 0.96
R6778:Dzip3 UTSW 16 48982083 missense probably benign 0.00
R6915:Dzip3 UTSW 16 48942125 missense possibly damaging 0.72
R7047:Dzip3 UTSW 16 48982126 missense probably benign 0.04
R7059:Dzip3 UTSW 16 48980942 missense probably benign 0.34
R7095:Dzip3 UTSW 16 48927790 missense probably benign
R7227:Dzip3 UTSW 16 48951569 missense probably damaging 0.99
R7319:Dzip3 UTSW 16 48927540 critical splice donor site probably null
R7436:Dzip3 UTSW 16 48951989 missense probably damaging 1.00
R7469:Dzip3 UTSW 16 48944879 missense probably benign
R7526:Dzip3 UTSW 16 48975474 missense probably damaging 0.99
R7964:Dzip3 UTSW 16 48951905 missense probably damaging 1.00
R8131:Dzip3 UTSW 16 48933793 critical splice donor site probably null
R8188:Dzip3 UTSW 16 48952136 missense probably damaging 1.00
R8209:Dzip3 UTSW 16 48977944 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGGCGATAATGGATGTTATTGGACCT -3'
(R):5'- TGCACCCAGAAAAGGCTGGGA -3'

Sequencing Primer
(F):5'- GACACTCAAAAAATGGTTTGCTGG -3'
(R):5'- TGGGATATGGAACCACCATCTTC -3'
Posted On2014-01-15