Incidental Mutation 'R1205:Morc2b'
ID100453
Institutional Source Beutler Lab
Gene Symbol Morc2b
Ensembl Gene ENSMUSG00000048602
Gene Namemicrorchidia 2B
Synonyms
MMRRC Submission 039275-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.253) question?
Stock #R1205 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location33135588-33139683 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 33135934 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 955 (Y955H)
Ref Sequence ENSEMBL: ENSMUSP00000123354 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053896] [ENSMUST00000131954]
Predicted Effect probably damaging
Transcript: ENSMUST00000053896
AA Change: Y955H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000056879
Gene: ENSMUSG00000048602
AA Change: Y955H

DomainStartEndE-ValueType
HATPase_c 24 134 5.78e0 SMART
coiled coil region 285 321 N/A INTRINSIC
Pfam:zf-CW 495 541 1.9e-16 PFAM
coiled coil region 555 584 N/A INTRINSIC
low complexity region 680 695 N/A INTRINSIC
coiled coil region 961 1001 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000131954
AA Change: Y955H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000123354
Gene: ENSMUSG00000048602
AA Change: Y955H

DomainStartEndE-ValueType
HATPase_c 24 134 5.78e0 SMART
coiled coil region 285 321 N/A INTRINSIC
Pfam:zf-CW 494 543 7.7e-18 PFAM
coiled coil region 555 584 N/A INTRINSIC
low complexity region 680 695 N/A INTRINSIC
coiled coil region 961 1001 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 90.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null mutation display male and female infertility with failure of chromosomal synapsis, double strand break repair, and recombination in meiosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrg6 T A 10: 14,434,339 N774I probably damaging Het
BC005561 T C 5: 104,520,213 L867S probably benign Het
Bpifc T A 10: 85,981,304 D230V probably damaging Het
Chrna2 C T 14: 66,143,363 A27V probably benign Het
Duox1 C T 2: 122,327,925 Q630* probably null Het
Dzip3 C T 16: 48,951,681 G542R probably damaging Het
Epha3 ATGAACTGCT AT 16: 63,598,248 probably null Het
Fam208a A T 14: 27,461,318 D578V probably damaging Het
Fnip1 G T 11: 54,502,306 V523L possibly damaging Het
Hc T A 2: 35,003,524 D1225V possibly damaging Het
Hnrnpu C T 1: 178,332,169 probably benign Het
Ift172 C T 5: 31,285,792 V125I probably benign Het
Kcnip2 T A 19: 45,794,983 Q93L probably null Het
Kif27 A T 13: 58,344,205 H373Q probably benign Het
Kl T C 5: 150,980,688 S302P probably damaging Het
Lyst G A 13: 13,680,202 V2386I probably benign Het
Map4k4 G A 1: 40,003,844 A128T probably damaging Het
March6 A C 15: 31,469,673 M717R probably benign Het
Myo7b A G 18: 31,994,342 S636P probably damaging Het
Neb T A 2: 52,222,984 D4266V probably damaging Het
Nynrin G A 14: 55,854,189 probably benign Het
Olfr1212 A T 2: 88,958,588 I41L probably benign Het
Olfr1457 T C 19: 13,095,535 I38V probably benign Het
Olfr347 G A 2: 36,734,755 V145I probably benign Het
Pcdh9 A G 14: 93,886,065 S890P probably benign Het
Pcnx G T 12: 81,956,243 D1052Y probably damaging Het
Pibf1 G A 14: 99,101,203 E52K probably damaging Het
Siglec1 T G 2: 131,080,464 S564R possibly damaging Het
Sin3a T A 9: 57,119,175 V1125E probably damaging Het
Slco4c1 G T 1: 96,867,888 D148E probably damaging Het
Spag6l A T 16: 16,787,307 L127Q probably damaging Het
Syne4 C A 7: 30,315,336 T68N probably damaging Het
Tas2r134 A G 2: 51,627,986 Y159C probably benign Het
Tmem132a C A 19: 10,859,084 R694L probably benign Het
Ttc28 C T 5: 111,285,769 P2192L probably benign Het
Ttc34 T G 4: 154,862,214 V857G probably benign Het
Ugt1a7c A T 1: 88,095,956 H279L probably benign Het
Vmn1r32 G A 6: 66,553,555 T79I probably benign Het
Vps13a A T 19: 16,640,541 V2960D probably damaging Het
Wee2 G T 6: 40,443,941 probably benign Het
Other mutations in Morc2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01323:Morc2b APN 17 33137319 missense possibly damaging 0.47
IGL01369:Morc2b APN 17 33138165 missense probably benign 0.12
IGL01533:Morc2b APN 17 33135721 utr 3 prime probably benign
IGL02003:Morc2b APN 17 33138324 missense probably benign 0.07
IGL02028:Morc2b APN 17 33137413 missense possibly damaging 0.78
IGL02152:Morc2b APN 17 33137943 missense probably damaging 1.00
IGL02341:Morc2b APN 17 33137307 missense probably damaging 1.00
IGL02976:Morc2b APN 17 33137523 missense possibly damaging 0.90
IGL03293:Morc2b APN 17 33138363 missense probably damaging 1.00
PIT4283001:Morc2b UTSW 17 33136068 missense probably benign 0.00
R0056:Morc2b UTSW 17 33138759 missense possibly damaging 0.78
R0116:Morc2b UTSW 17 33137041 missense probably damaging 1.00
R0179:Morc2b UTSW 17 33136982 nonsense probably null
R0533:Morc2b UTSW 17 33135932 nonsense probably null
R0556:Morc2b UTSW 17 33137838 missense probably benign 0.05
R0629:Morc2b UTSW 17 33135807 missense probably benign 0.00
R0635:Morc2b UTSW 17 33137687 missense possibly damaging 0.90
R0840:Morc2b UTSW 17 33136112 missense probably benign 0.01
R1566:Morc2b UTSW 17 33136974 missense probably benign 0.02
R1676:Morc2b UTSW 17 33135981 missense possibly damaging 0.82
R1892:Morc2b UTSW 17 33135774 missense probably damaging 1.00
R1954:Morc2b UTSW 17 33137490 missense probably damaging 1.00
R1955:Morc2b UTSW 17 33137490 missense probably damaging 1.00
R1969:Morc2b UTSW 17 33137091 missense probably benign 0.00
R2069:Morc2b UTSW 17 33136760 missense probably benign 0.13
R3609:Morc2b UTSW 17 33136278 missense probably damaging 1.00
R3610:Morc2b UTSW 17 33136278 missense probably damaging 1.00
R3831:Morc2b UTSW 17 33137259 missense probably benign 0.01
R4156:Morc2b UTSW 17 33138427 missense probably benign 0.43
R4243:Morc2b UTSW 17 33136401 missense probably benign 0.03
R4877:Morc2b UTSW 17 33138738 missense probably benign 0.26
R4911:Morc2b UTSW 17 33137377 missense probably damaging 1.00
R5230:Morc2b UTSW 17 33136252 missense probably benign 0.00
R5264:Morc2b UTSW 17 33138379 missense probably benign 0.03
R5326:Morc2b UTSW 17 33136933 missense probably benign 0.01
R5455:Morc2b UTSW 17 33138610 missense probably benign 0.29
R5933:Morc2b UTSW 17 33138609 missense possibly damaging 0.84
R5973:Morc2b UTSW 17 33137472 missense probably damaging 0.97
R6026:Morc2b UTSW 17 33137983 missense possibly damaging 0.55
R6113:Morc2b UTSW 17 33138068 nonsense probably null
R6393:Morc2b UTSW 17 33137776 missense probably damaging 0.97
R7066:Morc2b UTSW 17 33136636 missense probably benign 0.00
R7117:Morc2b UTSW 17 33137952 missense probably benign 0.00
R7120:Morc2b UTSW 17 33135813 missense probably damaging 1.00
R7130:Morc2b UTSW 17 33136288 missense possibly damaging 0.68
R7498:Morc2b UTSW 17 33137859 missense possibly damaging 0.55
R7516:Morc2b UTSW 17 33137461 missense probably benign 0.03
R7664:Morc2b UTSW 17 33136402 missense probably benign 0.12
R7754:Morc2b UTSW 17 33137244 missense probably benign 0.33
R7756:Morc2b UTSW 17 33137007 missense probably damaging 1.00
R7758:Morc2b UTSW 17 33137007 missense probably damaging 1.00
R7766:Morc2b UTSW 17 33138423 missense probably benign 0.19
Z1088:Morc2b UTSW 17 33136086 missense possibly damaging 0.49
Z1177:Morc2b UTSW 17 33137402 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGCATCTAGCTCATCATCTGCCC -3'
(R):5'- GAATGCTTCTGCACTGAACCCGAC -3'

Sequencing Primer
(F):5'- CTGATGTTTATGCCCTGCTGAG -3'
(R):5'- TGAACCCGACACTACTGCC -3'
Posted On2014-01-15