Incidental Mutation 'R1205:Olfr1457'
ID100458
Institutional Source Beutler Lab
Gene Symbol Olfr1457
Ensembl Gene ENSMUSG00000061637
Gene Nameolfactory receptor 1457
SynonymsGA_x6K02T2RE5P-3423041-3422097, MOR202-20
MMRRC Submission 039275-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.092) question?
Stock #R1205 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location13093379-13097891 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 13095535 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 38 (I38V)
Ref Sequence ENSEMBL: ENSMUSP00000150957 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075170] [ENSMUST00000208913] [ENSMUST00000214561] [ENSMUST00000215229]
Predicted Effect probably benign
Transcript: ENSMUST00000075170
AA Change: I38V

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000074665
Gene: ENSMUSG00000061637
AA Change: I38V

DomainStartEndE-ValueType
Pfam:7tm_4 32 309 3.6e-45 PFAM
Pfam:7tm_1 42 291 9.6e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000208913
Predicted Effect probably benign
Transcript: ENSMUST00000214561
Predicted Effect probably benign
Transcript: ENSMUST00000215229
AA Change: I38V

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 90.9%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrg6 T A 10: 14,434,339 N774I probably damaging Het
BC005561 T C 5: 104,520,213 L867S probably benign Het
Bpifc T A 10: 85,981,304 D230V probably damaging Het
Chrna2 C T 14: 66,143,363 A27V probably benign Het
Duox1 C T 2: 122,327,925 Q630* probably null Het
Dzip3 C T 16: 48,951,681 G542R probably damaging Het
Epha3 ATGAACTGCT AT 16: 63,598,248 probably null Het
Fam208a A T 14: 27,461,318 D578V probably damaging Het
Fnip1 G T 11: 54,502,306 V523L possibly damaging Het
Hc T A 2: 35,003,524 D1225V possibly damaging Het
Hnrnpu C T 1: 178,332,169 probably benign Het
Ift172 C T 5: 31,285,792 V125I probably benign Het
Kcnip2 T A 19: 45,794,983 Q93L probably null Het
Kif27 A T 13: 58,344,205 H373Q probably benign Het
Kl T C 5: 150,980,688 S302P probably damaging Het
Lyst G A 13: 13,680,202 V2386I probably benign Het
Map4k4 G A 1: 40,003,844 A128T probably damaging Het
March6 A C 15: 31,469,673 M717R probably benign Het
Morc2b A G 17: 33,135,934 Y955H probably damaging Het
Myo7b A G 18: 31,994,342 S636P probably damaging Het
Neb T A 2: 52,222,984 D4266V probably damaging Het
Nynrin G A 14: 55,854,189 probably benign Het
Olfr1212 A T 2: 88,958,588 I41L probably benign Het
Olfr347 G A 2: 36,734,755 V145I probably benign Het
Pcdh9 A G 14: 93,886,065 S890P probably benign Het
Pcnx G T 12: 81,956,243 D1052Y probably damaging Het
Pibf1 G A 14: 99,101,203 E52K probably damaging Het
Siglec1 T G 2: 131,080,464 S564R possibly damaging Het
Sin3a T A 9: 57,119,175 V1125E probably damaging Het
Slco4c1 G T 1: 96,867,888 D148E probably damaging Het
Spag6l A T 16: 16,787,307 L127Q probably damaging Het
Syne4 C A 7: 30,315,336 T68N probably damaging Het
Tas2r134 A G 2: 51,627,986 Y159C probably benign Het
Tmem132a C A 19: 10,859,084 R694L probably benign Het
Ttc28 C T 5: 111,285,769 P2192L probably benign Het
Ttc34 T G 4: 154,862,214 V857G probably benign Het
Ugt1a7c A T 1: 88,095,956 H279L probably benign Het
Vmn1r32 G A 6: 66,553,555 T79I probably benign Het
Vps13a A T 19: 16,640,541 V2960D probably damaging Het
Wee2 G T 6: 40,443,941 probably benign Het
Other mutations in Olfr1457
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01143:Olfr1457 APN 19 13095112 missense probably damaging 1.00
IGL01815:Olfr1457 APN 19 13095656 splice site probably null
IGL02033:Olfr1457 APN 19 13094857 missense possibly damaging 0.54
R0490:Olfr1457 UTSW 19 13094812 missense probably damaging 1.00
R1299:Olfr1457 UTSW 19 13095130 missense possibly damaging 0.78
R1782:Olfr1457 UTSW 19 13094803 missense probably damaging 0.99
R1983:Olfr1457 UTSW 19 13095384 missense probably benign 0.01
R2364:Olfr1457 UTSW 19 13094754 missense probably damaging 1.00
R3815:Olfr1457 UTSW 19 13094913 missense probably damaging 0.98
R4092:Olfr1457 UTSW 19 13095426 missense probably damaging 0.97
R4430:Olfr1457 UTSW 19 13095088 missense probably benign 0.03
R7200:Olfr1457 UTSW 19 13095232 missense probably benign 0.04
R8079:Olfr1457 UTSW 19 13095284 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ACGTCTGAGCAGCACAGTCATTG -3'
(R):5'- TGGAATGGACTTCACCTAGAGAAGACC -3'

Sequencing Primer
(F):5'- CACAGTCATTGTAGGAAATGACC -3'
(R):5'- TGTTCAACCAAGTCATAGTTCCAC -3'
Posted On2014-01-15