Mutagenetix > Incidental Mutations

Incidental Mutation 'R1208:Sycp2'

100506

Institutional Source

Beutler Lab

Gene Symbol

Sycp2

Ensembl Gene

ENSMUSG00000060445

Gene Name

synaptonemal complex protein 2

Synonyms

3830402K23Rik, 4930518F03Rik

MMRRC Submission

039277-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1208 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

178345293-178407685 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 178356628 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Asparagine at position 1033 (I1033N)

Ref Sequence

ENSEMBL: ENSMUSP00000079909 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000081134]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000081134
AA Change: I1033N

PolyPhen 2 Score 0.917 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000079909
Gene: ENSMUSG00000060445
AA Change: I1033N

Domain	Start	End	E-Value	Type
low complexity region	945	960	N/A	INTRINSIC
low complexity region	1006	1019	N/A	INTRINSIC
low complexity region	1076	1091	N/A	INTRINSIC
low complexity region	1195	1204	N/A	INTRINSIC
low complexity region	1273	1293	N/A	INTRINSIC
low complexity region	1355	1364	N/A	INTRINSIC
coiled coil region	1387	1429	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000132611

Coding Region Coverage

1x: 99.3%
3x: 97.8%
10x: 91.7%
20x: 74.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The synaptonemal complex is a proteinaceous structure that links homologous chromosomes during the prophase of meiosis. The protein encoded by this gene is a major component of the synaptonemal complex and may bind DNA at scaffold attachment regions. The encoded protein requires synaptonemal complex protein 3, but not 1, for inclusion in the synaptonemal complex. [provided by RefSeq, Jul 2008]
PHENOTYPE: Male mice homozygous for a knock-out allele are sterile due to lack of axial element formation and subsequent failure of chromosome synapsis in prophase I spermatocytes, while females are subfertile with a sharply reduced litter size. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 29 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Atp13a3	A	T	16: 30,354,247	C271S	probably benign	Het
Ccl25	T	A	8: 4,357,631	S199T	possibly damaging	Het
Cdh15	G	C	8: 122,857,495	E112Q	probably damaging	Het
Cep104	A	T	4: 153,985,379	D270V	probably damaging	Het
Dnah5	T	A	15: 28,327,731	Y2084N	probably damaging	Het
Eftud2	A	G	11: 102,864,766	V214A	probably benign	Het
Epb41l4b	C	T	4: 57,077,252		probably null	Het
Fam129c	A	T	8: 71,600,475	T125S	probably damaging	Het
Gm8298	C	T	3: 59,865,294	P73L	probably benign	Het
Golgb1	AAGAGAGAGAGAGAGA	AAGAGAGAGAGAGA	16: 36,915,205		probably null	Het
Gys2	A	G	6: 142,450,467		probably null	Het
Lig4	T	C	8: 9,971,062	E906G	probably damaging	Het
Mast3	G	A	8: 70,788,272		probably null	Het
Mta2	G	A	19: 8,951,017	R560H	probably damaging	Het
Myom2	T	C	8: 15,084,631	L478P	probably damaging	Het
Neb	A	T	2: 52,303,900	L673*	probably null	Het
Olfr1260	G	A	2: 89,978,492	C238Y	probably damaging	Het
Pdpk1	C	A	17: 24,093,609		probably null	Het
Perm1	T	C	4: 156,217,002	M1T	probably null	Het
Pphln1	T	C	15: 93,459,729	W162R	probably damaging	Het
Ppp1r13b	A	G	12: 111,844,905	V183A	probably damaging	Het
Recql5	T	C	11: 115,893,156	K951E	probably damaging	Het
Slc25a25	T	C	2: 32,417,425	E309G	probably benign	Het
Tbpl2	A	T	2: 24,094,771	N120K	probably benign	Het
Unc5b	A	T	10: 60,766,992	L876Q	probably damaging	Het
Usp9y	T	C	Y: 1,356,282	T1140A	probably benign	Het
Vmn1r40	A	G	6: 89,714,344	I48V	probably benign	Het
Zbbx	T	C	3: 75,037,992	I708V	possibly damaging	Het
Zfp318	AGAAGA	AGAAGAGGAAGA	17: 46,412,520		probably benign	Het

Other mutations in Sycp2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00484:Sycp2	APN	2	178382348	missense	probably damaging	1.00
IGL00578:Sycp2	APN	2	178350822	splice site	probably benign
IGL00646:Sycp2	APN	2	178374459	missense	probably benign	0.00
IGL01309:Sycp2	APN	2	178358111	missense	probably benign	0.15
IGL01464:Sycp2	APN	2	178401632	missense	probably damaging	0.96
IGL01539:Sycp2	APN	2	178374695	missense	probably damaging	1.00
IGL01670:Sycp2	APN	2	178378050	missense	probably benign	0.00
IGL02138:Sycp2	APN	2	178358254	missense	probably benign	0.31
IGL02138:Sycp2	APN	2	178401990	nonsense	probably null
IGL02630:Sycp2	APN	2	178401919	missense	probably damaging	1.00
IGL02673:Sycp2	APN	2	178394211	missense	possibly damaging	0.63
IGL02961:Sycp2	APN	2	178380862	missense	probably benign	0.01
IGL03084:Sycp2	APN	2	178391791	unclassified	probably benign
IGL03123:Sycp2	APN	2	178352479	nonsense	probably null
IGL03167:Sycp2	APN	2	178379498	missense	probably damaging	0.99
R0043:Sycp2	UTSW	2	178364711	missense	probably damaging	1.00
R0050:Sycp2	UTSW	2	178364711	missense	probably damaging	1.00
R0096:Sycp2	UTSW	2	178403735	missense	probably damaging	0.99
R0096:Sycp2	UTSW	2	178403735	missense	probably damaging	0.99
R0310:Sycp2	UTSW	2	178381855	missense	probably benign	0.44
R0363:Sycp2	UTSW	2	178346411	splice site	probably benign
R0456:Sycp2	UTSW	2	178381855	missense	probably benign	0.44
R0597:Sycp2	UTSW	2	178356580	missense	possibly damaging	0.54
R0608:Sycp2	UTSW	2	178382404	missense	probably damaging	0.98
R1112:Sycp2	UTSW	2	178352536	missense	probably benign	0.05
R1127:Sycp2	UTSW	2	178374366	missense	possibly damaging	0.72
R1208:Sycp2	UTSW	2	178356628	missense	possibly damaging	0.92
R1323:Sycp2	UTSW	2	178347621	missense	possibly damaging	0.50
R1323:Sycp2	UTSW	2	178347621	missense	possibly damaging	0.50
R1413:Sycp2	UTSW	2	178347797	missense	probably benign	0.00
R1557:Sycp2	UTSW	2	178395216	unclassified	probably benign
R1562:Sycp2	UTSW	2	178382385	missense	probably damaging	1.00
R1585:Sycp2	UTSW	2	178351668	missense	possibly damaging	0.50
R1932:Sycp2	UTSW	2	178381957	missense	probably damaging	1.00
R1950:Sycp2	UTSW	2	178402800	missense	probably benign	0.00
R2001:Sycp2	UTSW	2	178378055	missense	probably benign	0.05
R2105:Sycp2	UTSW	2	178350138	splice site	probably null
R2382:Sycp2	UTSW	2	178378018	critical splice donor site	probably null
R2403:Sycp2	UTSW	2	178403735	nonsense	probably null
R2483:Sycp2	UTSW	2	178374595	missense	probably damaging	0.98
R3003:Sycp2	UTSW	2	178358123	missense	probably benign	0.01
R3418:Sycp2	UTSW	2	178401653	splice site	probably benign
R3686:Sycp2	UTSW	2	178374384	missense	probably benign	0.16
R4038:Sycp2	UTSW	2	178380927	missense	possibly damaging	0.72
R4039:Sycp2	UTSW	2	178380927	missense	possibly damaging	0.72
R4272:Sycp2	UTSW	2	178358224	missense	probably benign	0.04
R4343:Sycp2	UTSW	2	178380947	missense	probably damaging	0.99
R4491:Sycp2	UTSW	2	178374985	missense	probably damaging	1.00
R4534:Sycp2	UTSW	2	178355009	missense	probably damaging	1.00
R4720:Sycp2	UTSW	2	178374432	missense	probably benign	0.11
R4805:Sycp2	UTSW	2	178393961	unclassified	probably benign
R4807:Sycp2	UTSW	2	178393961	unclassified	probably benign
R4808:Sycp2	UTSW	2	178393961	unclassified	probably benign
R4906:Sycp2	UTSW	2	178403657	critical splice donor site	probably null
R4910:Sycp2	UTSW	2	178358224	missense	probably benign	0.04
R5282:Sycp2	UTSW	2	178403761	missense	probably damaging	1.00
R5285:Sycp2	UTSW	2	178392398	splice site	probably null
R5316:Sycp2	UTSW	2	178356503	missense	probably benign	0.00
R5389:Sycp2	UTSW	2	178377702	splice site	probably null
R5621:Sycp2	UTSW	2	178381918	missense	probably benign	0.05
R5652:Sycp2	UTSW	2	178358705	splice site	probably null
R5880:Sycp2	UTSW	2	178374470	missense	possibly damaging	0.92
R6114:Sycp2	UTSW	2	178348245	missense	probably benign	0.25
R6115:Sycp2	UTSW	2	178348245	missense	probably benign	0.25
R6186:Sycp2	UTSW	2	178383560	missense	probably damaging	0.97
R6351:Sycp2	UTSW	2	178363416	missense	probably damaging	1.00
R6509:Sycp2	UTSW	2	178395894	missense	probably damaging	1.00
R6536:Sycp2	UTSW	2	178351648	missense	probably damaging	1.00
R6679:Sycp2	UTSW	2	178380928	missense	probably damaging	0.96
R6687:Sycp2	UTSW	2	178354960	missense	probably damaging	0.99
R6761:Sycp2	UTSW	2	178374351	splice site	probably null
R6786:Sycp2	UTSW	2	178383552	missense	possibly damaging	0.63
R7357:Sycp2	UTSW	2	178403804	splice site	probably null
R7422:Sycp2	UTSW	2	178394151	missense	probably damaging	1.00
R7519:Sycp2	UTSW	2	178346333	makesense	probably null
R7805:Sycp2	UTSW	2	178380858	missense	probably damaging	0.99
R8022:Sycp2	UTSW	2	178355062	missense	probably damaging	1.00
R8037:Sycp2	UTSW	2	178403778	missense	probably damaging	1.00
R8038:Sycp2	UTSW	2	178403778	missense	probably damaging	1.00
R8039:Sycp2	UTSW	2	178374585	missense	probably benign	0.05
Z1088:Sycp2	UTSW	2	178374367	missense	probably benign
Z1088:Sycp2	UTSW	2	178381934	missense	probably benign	0.17
Z1176:Sycp2	UTSW	2	178364881	missense	probably damaging	1.00
Z1177:Sycp2	UTSW	2	178380875	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCATCACTTCCACAGAGGACGAGC -3'
(R):5'- GCAAAGACCCGAGTTTCTCAAGTGC -3'

Sequencing Primer
(F):5'- AGCTCCTGGACACAGACG -3'
(R):5'- GGCACACAAACTTTAGTGTCTC -3'

Posted On

2014-01-15