Incidental Mutation 'R1208:Gm8298'
ID100508
Institutional Source Beutler Lab
Gene Symbol Gm8298
Ensembl Gene ENSMUSG00000095522
Gene Namepredicted gene 8298
Synonyms
MMRRC Submission 039277-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.091) question?
Stock #R1208 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location59861051-59877313 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 59865294 bp
ZygosityHeterozygous
Amino Acid Change Proline to Leucine at position 73 (P73L)
Ref Sequence ENSEMBL: ENSMUSP00000137307 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000179799]
Predicted Effect probably benign
Transcript: ENSMUST00000179799
AA Change: P73L

PolyPhen 2 Score 0.266 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000137307
Gene: ENSMUSG00000095522
AA Change: P73L

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:COesterase 91 217 9.6e-7 PFAM
Pfam:Abhydrolase_3 107 279 1.1e-36 PFAM
Pfam:Abhydrolase_3 284 375 1.2e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194941
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 97.8%
  • 10x: 91.7%
  • 20x: 74.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atp13a3 A T 16: 30,354,247 C271S probably benign Het
Ccl25 T A 8: 4,357,631 S199T possibly damaging Het
Cdh15 G C 8: 122,857,495 E112Q probably damaging Het
Cep104 A T 4: 153,985,379 D270V probably damaging Het
Dnah5 T A 15: 28,327,731 Y2084N probably damaging Het
Eftud2 A G 11: 102,864,766 V214A probably benign Het
Epb41l4b C T 4: 57,077,252 probably null Het
Fam129c A T 8: 71,600,475 T125S probably damaging Het
Golgb1 AAGAGAGAGAGAGAGA AAGAGAGAGAGAGA 16: 36,915,205 probably null Het
Gys2 A G 6: 142,450,467 probably null Het
Lig4 T C 8: 9,971,062 E906G probably damaging Het
Mast3 G A 8: 70,788,272 probably null Het
Mta2 G A 19: 8,951,017 R560H probably damaging Het
Myom2 T C 8: 15,084,631 L478P probably damaging Het
Neb A T 2: 52,303,900 L673* probably null Het
Olfr1260 G A 2: 89,978,492 C238Y probably damaging Het
Pdpk1 C A 17: 24,093,609 probably null Het
Perm1 T C 4: 156,217,002 M1T probably null Het
Pphln1 T C 15: 93,459,729 W162R probably damaging Het
Ppp1r13b A G 12: 111,844,905 V183A probably damaging Het
Recql5 T C 11: 115,893,156 K951E probably damaging Het
Slc25a25 T C 2: 32,417,425 E309G probably benign Het
Sycp2 A T 2: 178,356,628 I1033N possibly damaging Het
Tbpl2 A T 2: 24,094,771 N120K probably benign Het
Unc5b A T 10: 60,766,992 L876Q probably damaging Het
Usp9y T C Y: 1,356,282 T1140A probably benign Het
Vmn1r40 A G 6: 89,714,344 I48V probably benign Het
Zbbx T C 3: 75,037,992 I708V possibly damaging Het
Zfp318 AGAAGA AGAAGAGGAAGA 17: 46,412,520 probably benign Het
Other mutations in Gm8298
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01712:Gm8298 APN 3 59868900 missense possibly damaging 0.80
IGL02064:Gm8298 APN 3 59877042 missense probably damaging 1.00
IGL02317:Gm8298 APN 3 59876987 missense probably benign 0.00
R0270:Gm8298 UTSW 3 59877019 missense probably benign
R0580:Gm8298 UTSW 3 59877049 missense probably damaging 1.00
R1124:Gm8298 UTSW 3 59865218 missense probably benign 0.39
R1222:Gm8298 UTSW 3 59877261 nonsense probably null
R1436:Gm8298 UTSW 3 59865339 missense probably damaging 0.98
R1529:Gm8298 UTSW 3 59861112 missense probably benign
R1806:Gm8298 UTSW 3 59877150 missense probably damaging 1.00
R2130:Gm8298 UTSW 3 59865348 missense probably damaging 1.00
R4209:Gm8298 UTSW 3 59877156 missense probably damaging 1.00
R4597:Gm8298 UTSW 3 59876793 missense possibly damaging 0.47
R4910:Gm8298 UTSW 3 59869014 critical splice donor site probably null
R5571:Gm8298 UTSW 3 59877219 missense probably damaging 1.00
R6131:Gm8298 UTSW 3 59868903 missense possibly damaging 0.76
R6447:Gm8298 UTSW 3 59865398 missense probably damaging 0.99
R6481:Gm8298 UTSW 3 59861057 missense probably benign 0.00
R6795:Gm8298 UTSW 3 59868936 missense probably damaging 1.00
R7092:Gm8298 UTSW 3 59861079 missense probably benign 0.41
R7334:Gm8298 UTSW 3 59868959 missense probably damaging 1.00
R7602:Gm8298 UTSW 3 59877276 missense probably benign 0.17
R7660:Gm8298 UTSW 3 59865268 missense probably benign 0.05
R7705:Gm8298 UTSW 3 59876747 missense probably benign 0.25
R7708:Gm8298 UTSW 3 59865335 missense probably benign 0.00
R8167:Gm8298 UTSW 3 59877211 missense probably benign 0.03
X0011:Gm8298 UTSW 3 59861177 missense probably benign
X0022:Gm8298 UTSW 3 59877024 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- tgccccacGCACTACCTACTAATC -3'
(R):5'- CTGCGGGAGAAAGTATGTCAAGGTC -3'

Sequencing Primer
(F):5'- ccacGCACTACCTACTAATCTTTTC -3'
(R):5'- GAAAGTATGTCAAGGTCAGTGTTCC -3'
Posted On2014-01-15