Incidental Mutation 'R1208:Zbbx'
ID100510
Institutional Source Beutler Lab
Gene Symbol Zbbx
Ensembl Gene ENSMUSG00000034151
Gene Namezinc finger, B-box domain containing
Synonyms
MMRRC Submission 039277-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock #R1208 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location75037907-75165034 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 75037992 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 708 (I708V)
Ref Sequence ENSEMBL: ENSMUSP00000103407 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039269] [ENSMUST00000107778]
Predicted Effect possibly damaging
Transcript: ENSMUST00000039269
AA Change: I703V

PolyPhen 2 Score 0.935 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000043970
Gene: ENSMUSG00000034151
AA Change: I703V

DomainStartEndE-ValueType
Blast:BBOX 13 58 5e-22 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000107778
AA Change: I708V

PolyPhen 2 Score 0.935 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000103407
Gene: ENSMUSG00000034151
AA Change: I708V

DomainStartEndE-ValueType
Blast:BBOX 13 58 5e-22 BLAST
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 97.8%
  • 10x: 91.7%
  • 20x: 74.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atp13a3 A T 16: 30,354,247 C271S probably benign Het
Ccl25 T A 8: 4,357,631 S199T possibly damaging Het
Cdh15 G C 8: 122,857,495 E112Q probably damaging Het
Cep104 A T 4: 153,985,379 D270V probably damaging Het
Dnah5 T A 15: 28,327,731 Y2084N probably damaging Het
Eftud2 A G 11: 102,864,766 V214A probably benign Het
Epb41l4b C T 4: 57,077,252 probably null Het
Fam129c A T 8: 71,600,475 T125S probably damaging Het
Gm8298 C T 3: 59,865,294 P73L probably benign Het
Golgb1 AAGAGAGAGAGAGAGA AAGAGAGAGAGAGA 16: 36,915,205 probably null Het
Gys2 A G 6: 142,450,467 probably null Het
Lig4 T C 8: 9,971,062 E906G probably damaging Het
Mast3 G A 8: 70,788,272 probably null Het
Mta2 G A 19: 8,951,017 R560H probably damaging Het
Myom2 T C 8: 15,084,631 L478P probably damaging Het
Neb A T 2: 52,303,900 L673* probably null Het
Olfr1260 G A 2: 89,978,492 C238Y probably damaging Het
Pdpk1 C A 17: 24,093,609 probably null Het
Perm1 T C 4: 156,217,002 M1T probably null Het
Pphln1 T C 15: 93,459,729 W162R probably damaging Het
Ppp1r13b A G 12: 111,844,905 V183A probably damaging Het
Recql5 T C 11: 115,893,156 K951E probably damaging Het
Slc25a25 T C 2: 32,417,425 E309G probably benign Het
Sycp2 A T 2: 178,356,628 I1033N possibly damaging Het
Tbpl2 A T 2: 24,094,771 N120K probably benign Het
Unc5b A T 10: 60,766,992 L876Q probably damaging Het
Usp9y T C Y: 1,356,282 T1140A probably benign Het
Vmn1r40 A G 6: 89,714,344 I48V probably benign Het
Zfp318 AGAAGA AGAAGAGGAAGA 17: 46,412,520 probably benign Het
Other mutations in Zbbx
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00561:Zbbx APN 3 75061532 critical splice donor site probably null
IGL01328:Zbbx APN 3 75093075 nonsense probably null
IGL01340:Zbbx APN 3 75105650 missense possibly damaging 0.53
IGL01631:Zbbx APN 3 75078677 missense probably damaging 0.99
IGL01681:Zbbx APN 3 75052478 missense probably damaging 1.00
IGL02427:Zbbx APN 3 75139598 missense probably benign 0.04
IGL03077:Zbbx APN 3 75081846 missense possibly damaging 0.61
IGL03115:Zbbx APN 3 75078560 missense probably benign 0.03
IGL03162:Zbbx APN 3 75071623 splice site probably benign
Eland UTSW 3 75071712 missense probably benign 0.01
PIT4480001:Zbbx UTSW 3 75136487 missense probably damaging 1.00
PIT4495001:Zbbx UTSW 3 75061637 missense probably damaging 1.00
R0179:Zbbx UTSW 3 75085562 splice site probably benign
R0396:Zbbx UTSW 3 75078495 missense possibly damaging 0.81
R0523:Zbbx UTSW 3 75081858 missense probably benign 0.03
R0603:Zbbx UTSW 3 75078450 missense probably benign 0.05
R0745:Zbbx UTSW 3 75155427 missense probably damaging 1.00
R0747:Zbbx UTSW 3 75155427 missense probably damaging 1.00
R1208:Zbbx UTSW 3 75037992 missense possibly damaging 0.94
R1371:Zbbx UTSW 3 75052477 missense possibly damaging 0.58
R1769:Zbbx UTSW 3 75083619 splice site probably benign
R1906:Zbbx UTSW 3 75071740 missense probably damaging 1.00
R2069:Zbbx UTSW 3 75078412 missense probably benign 0.01
R2165:Zbbx UTSW 3 75112107 missense probably damaging 0.99
R2174:Zbbx UTSW 3 75052414 missense possibly damaging 0.93
R2979:Zbbx UTSW 3 75078486 nonsense probably null
R3121:Zbbx UTSW 3 75081846 missense possibly damaging 0.88
R3755:Zbbx UTSW 3 75105671 missense probably damaging 1.00
R3756:Zbbx UTSW 3 75105671 missense probably damaging 1.00
R3816:Zbbx UTSW 3 75085495 missense probably benign 0.00
R4002:Zbbx UTSW 3 75105671 missense probably damaging 1.00
R4003:Zbbx UTSW 3 75105671 missense probably damaging 1.00
R4057:Zbbx UTSW 3 75105671 missense probably damaging 1.00
R4072:Zbbx UTSW 3 75105671 missense probably damaging 1.00
R4073:Zbbx UTSW 3 75105671 missense probably damaging 1.00
R4075:Zbbx UTSW 3 75105671 missense probably damaging 1.00
R4114:Zbbx UTSW 3 75139598 missense probably benign 0.04
R4784:Zbbx UTSW 3 75085041 missense probably benign 0.05
R4821:Zbbx UTSW 3 75081747 missense possibly damaging 0.68
R5008:Zbbx UTSW 3 75151448 missense possibly damaging 0.62
R5030:Zbbx UTSW 3 75083683 missense possibly damaging 0.83
R5388:Zbbx UTSW 3 75083670 missense probably damaging 0.98
R6398:Zbbx UTSW 3 75078565 missense probably damaging 0.96
R6462:Zbbx UTSW 3 75078659 missense probably benign 0.07
R6597:Zbbx UTSW 3 75136454 missense probably damaging 1.00
R6882:Zbbx UTSW 3 75071712 missense probably benign 0.01
R7084:Zbbx UTSW 3 75139546 missense possibly damaging 0.92
R7096:Zbbx UTSW 3 75081737 missense probably benign 0.03
R7102:Zbbx UTSW 3 75112094 missense probably benign 0.06
R7256:Zbbx UTSW 3 75039898 missense probably benign 0.02
R7537:Zbbx UTSW 3 75085519 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTTAAACACAAACCTGTTCCGTCC -3'
(R):5'- ACTCAGCCTGCTTCCAAAGACTTC -3'

Sequencing Primer
(F):5'- CATGCAATATGGTGTCTGGAAG -3'
(R):5'- GCATTTCCAGCTCTTCTGGAA -3'
Posted On2014-01-15