Incidental Mutation 'R1208:Epb41l4b'
ID100512
Institutional Source Beutler Lab
Gene Symbol Epb41l4b
Ensembl Gene ENSMUSG00000028434
Gene Nameerythrocyte membrane protein band 4.1 like 4b
Synonyms6430543G08Rik, D4Ertd346e, Lulu2, Epb4.1l4b, Ehm2
MMRRC Submission 039277-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1208 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location56991972-57143437 bp(-) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) C to T at 57077252 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000092687 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030142] [ENSMUST00000095076]
Predicted Effect probably null
Transcript: ENSMUST00000030142
SMART Domains Protein: ENSMUSP00000030142
Gene: ENSMUSG00000028434

DomainStartEndE-ValueType
low complexity region 18 57 N/A INTRINSIC
low complexity region 60 72 N/A INTRINSIC
B41 81 277 4.09e-69 SMART
FERM_C 281 373 1.76e-35 SMART
FA 378 422 2.86e-12 SMART
Predicted Effect probably null
Transcript: ENSMUST00000095076
SMART Domains Protein: ENSMUSP00000092687
Gene: ENSMUSG00000028434

DomainStartEndE-ValueType
low complexity region 18 57 N/A INTRINSIC
low complexity region 60 72 N/A INTRINSIC
B41 81 277 4.09e-69 SMART
FERM_C 281 373 1.76e-35 SMART
FA 378 422 2.86e-12 SMART
low complexity region 504 513 N/A INTRINSIC
low complexity region 692 704 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136337
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149109
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 97.8%
  • 10x: 91.7%
  • 20x: 74.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atp13a3 A T 16: 30,354,247 C271S probably benign Het
Ccl25 T A 8: 4,357,631 S199T possibly damaging Het
Cdh15 G C 8: 122,857,495 E112Q probably damaging Het
Cep104 A T 4: 153,985,379 D270V probably damaging Het
Dnah5 T A 15: 28,327,731 Y2084N probably damaging Het
Eftud2 A G 11: 102,864,766 V214A probably benign Het
Fam129c A T 8: 71,600,475 T125S probably damaging Het
Gm8298 C T 3: 59,865,294 P73L probably benign Het
Golgb1 AAGAGAGAGAGAGAGA AAGAGAGAGAGAGA 16: 36,915,205 probably null Het
Gys2 A G 6: 142,450,467 probably null Het
Lig4 T C 8: 9,971,062 E906G probably damaging Het
Mast3 G A 8: 70,788,272 probably null Het
Mta2 G A 19: 8,951,017 R560H probably damaging Het
Myom2 T C 8: 15,084,631 L478P probably damaging Het
Neb A T 2: 52,303,900 L673* probably null Het
Olfr1260 G A 2: 89,978,492 C238Y probably damaging Het
Pdpk1 C A 17: 24,093,609 probably null Het
Perm1 T C 4: 156,217,002 M1T probably null Het
Pphln1 T C 15: 93,459,729 W162R probably damaging Het
Ppp1r13b A G 12: 111,844,905 V183A probably damaging Het
Recql5 T C 11: 115,893,156 K951E probably damaging Het
Slc25a25 T C 2: 32,417,425 E309G probably benign Het
Sycp2 A T 2: 178,356,628 I1033N possibly damaging Het
Tbpl2 A T 2: 24,094,771 N120K probably benign Het
Unc5b A T 10: 60,766,992 L876Q probably damaging Het
Usp9y T C Y: 1,356,282 T1140A probably benign Het
Vmn1r40 A G 6: 89,714,344 I48V probably benign Het
Zbbx T C 3: 75,037,992 I708V possibly damaging Het
Zfp318 AGAAGA AGAAGAGGAAGA 17: 46,412,520 probably benign Het
Other mutations in Epb41l4b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02141:Epb41l4b APN 4 57103422 critical splice donor site probably null
IGL02311:Epb41l4b APN 4 57076456 missense probably damaging 1.00
Episode UTSW 4 57142866 missense probably benign 0.00
R0456:Epb41l4b UTSW 4 57142843 splice site probably null
R0799:Epb41l4b UTSW 4 57086003 missense probably damaging 1.00
R0905:Epb41l4b UTSW 4 57103528 missense probably damaging 1.00
R1208:Epb41l4b UTSW 4 57077252 critical splice acceptor site probably null
R1506:Epb41l4b UTSW 4 57088824 missense probably damaging 1.00
R1618:Epb41l4b UTSW 4 57032204 missense probably benign 0.00
R1919:Epb41l4b UTSW 4 57040993 missense probably damaging 0.99
R1956:Epb41l4b UTSW 4 57038553 missense possibly damaging 0.94
R2041:Epb41l4b UTSW 4 57084070 missense probably damaging 0.98
R2048:Epb41l4b UTSW 4 57142866 missense probably benign 0.00
R3434:Epb41l4b UTSW 4 57040865 missense probably benign 0.41
R4059:Epb41l4b UTSW 4 57024337 critical splice donor site probably null
R4175:Epb41l4b UTSW 4 57076556 missense probably damaging 1.00
R4694:Epb41l4b UTSW 4 57019875 missense probably benign 0.01
R4817:Epb41l4b UTSW 4 57103428 missense probably damaging 1.00
R5076:Epb41l4b UTSW 4 57040984 missense probably damaging 1.00
R5179:Epb41l4b UTSW 4 57063181 missense probably benign 0.01
R5246:Epb41l4b UTSW 4 57040989 missense probably damaging 0.99
R5530:Epb41l4b UTSW 4 57086003 missense probably damaging 1.00
R5579:Epb41l4b UTSW 4 57064802 missense possibly damaging 0.62
R5784:Epb41l4b UTSW 4 57086003 missense probably damaging 1.00
R6772:Epb41l4b UTSW 4 57063140 missense probably benign
R6965:Epb41l4b UTSW 4 57040915 missense probably damaging 1.00
R7045:Epb41l4b UTSW 4 57103522 missense possibly damaging 0.94
R7316:Epb41l4b UTSW 4 57019867 missense probably benign 0.01
R7750:Epb41l4b UTSW 4 57076913 critical splice donor site probably null
Z1177:Epb41l4b UTSW 4 57063191 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGAGGGTTCTAACAGGTCGTCACAG -3'
(R):5'- TGCAGACGTACAGTCAATGTGCC -3'

Sequencing Primer
(F):5'- TTCTAACAGGTCGTCACAGAGAAG -3'
(R):5'- TAAGAAACACCATCCTGTGGTCTTC -3'
Posted On2014-01-15