Incidental Mutation 'R1208:Vmn1r40'
ID100518
Institutional Source Beutler Lab
Gene Symbol Vmn1r40
Ensembl Gene ENSMUSG00000096051
Gene Namevomeronasal 1 receptor 40
SynonymsV1rb7
MMRRC Submission 039277-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.070) question?
Stock #R1208 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location89707540-89716657 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 89714344 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 48 (I48V)
Ref Sequence ENSEMBL: ENSMUSP00000154581 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075158] [ENSMUST00000226925] [ENSMUST00000227669] [ENSMUST00000228485] [ENSMUST00000228642]
Predicted Effect probably benign
Transcript: ENSMUST00000075158
AA Change: I48V

PolyPhen 2 Score 0.129 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000074655
Gene: ENSMUSG00000096051
AA Change: I48V

DomainStartEndE-ValueType
transmembrane domain 15 37 N/A INTRINSIC
Pfam:V1R 38 302 3.4e-143 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000226925
AA Change: I48V

PolyPhen 2 Score 0.129 (Sensitivity: 0.93; Specificity: 0.86)
Predicted Effect probably benign
Transcript: ENSMUST00000227669
Predicted Effect probably benign
Transcript: ENSMUST00000228485
Predicted Effect probably benign
Transcript: ENSMUST00000228642
AA Change: I48V

PolyPhen 2 Score 0.129 (Sensitivity: 0.93; Specificity: 0.86)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 97.8%
  • 10x: 91.7%
  • 20x: 74.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atp13a3 A T 16: 30,354,247 C271S probably benign Het
Ccl25 T A 8: 4,357,631 S199T possibly damaging Het
Cdh15 G C 8: 122,857,495 E112Q probably damaging Het
Cep104 A T 4: 153,985,379 D270V probably damaging Het
Dnah5 T A 15: 28,327,731 Y2084N probably damaging Het
Eftud2 A G 11: 102,864,766 V214A probably benign Het
Epb41l4b C T 4: 57,077,252 probably null Het
Fam129c A T 8: 71,600,475 T125S probably damaging Het
Gm8298 C T 3: 59,865,294 P73L probably benign Het
Golgb1 AAGAGAGAGAGAGAGA AAGAGAGAGAGAGA 16: 36,915,205 probably null Het
Gys2 A G 6: 142,450,467 probably null Het
Lig4 T C 8: 9,971,062 E906G probably damaging Het
Mast3 G A 8: 70,788,272 probably null Het
Mta2 G A 19: 8,951,017 R560H probably damaging Het
Myom2 T C 8: 15,084,631 L478P probably damaging Het
Neb A T 2: 52,303,900 L673* probably null Het
Olfr1260 G A 2: 89,978,492 C238Y probably damaging Het
Pdpk1 C A 17: 24,093,609 probably null Het
Perm1 T C 4: 156,217,002 M1T probably null Het
Pphln1 T C 15: 93,459,729 W162R probably damaging Het
Ppp1r13b A G 12: 111,844,905 V183A probably damaging Het
Recql5 T C 11: 115,893,156 K951E probably damaging Het
Slc25a25 T C 2: 32,417,425 E309G probably benign Het
Sycp2 A T 2: 178,356,628 I1033N possibly damaging Het
Tbpl2 A T 2: 24,094,771 N120K probably benign Het
Unc5b A T 10: 60,766,992 L876Q probably damaging Het
Usp9y T C Y: 1,356,282 T1140A probably benign Het
Zbbx T C 3: 75,037,992 I708V possibly damaging Het
Zfp318 AGAAGA AGAAGAGGAAGA 17: 46,412,520 probably benign Het
Other mutations in Vmn1r40
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01099:Vmn1r40 APN 6 89714596 missense probably damaging 0.99
IGL01432:Vmn1r40 APN 6 89714219 missense probably benign
IGL01777:Vmn1r40 APN 6 89714222 missense probably benign 0.38
IGL01834:Vmn1r40 APN 6 89714572 missense possibly damaging 0.62
IGL01908:Vmn1r40 APN 6 89714309 missense probably damaging 0.97
IGL01908:Vmn1r40 APN 6 89714303 missense probably benign 0.00
IGL01999:Vmn1r40 APN 6 89714966 missense probably benign 0.00
IGL02728:Vmn1r40 APN 6 89715016 missense probably benign 0.05
IGL03169:Vmn1r40 APN 6 89715023 missense probably damaging 0.97
R0448:Vmn1r40 UTSW 6 89714660 missense probably benign 0.23
R0971:Vmn1r40 UTSW 6 89714290 missense probably benign 0.00
R1208:Vmn1r40 UTSW 6 89714344 missense probably benign 0.13
R1448:Vmn1r40 UTSW 6 89714576 missense probably damaging 1.00
R1739:Vmn1r40 UTSW 6 89714315 missense probably benign 0.00
R2170:Vmn1r40 UTSW 6 89714975 missense probably benign 0.11
R3151:Vmn1r40 UTSW 6 89714566 missense probably benign 0.01
R3804:Vmn1r40 UTSW 6 89715009 missense probably benign 0.29
R5098:Vmn1r40 UTSW 6 89714948 missense probably damaging 1.00
R6015:Vmn1r40 UTSW 6 89714606 missense probably damaging 1.00
R7216:Vmn1r40 UTSW 6 89714624 missense not run
R7555:Vmn1r40 UTSW 6 89715044 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTTGGCATTTGTGAACAAGGCCATC -3'
(R):5'- TGCAGAAAACATGCTTGTCCTGGAG -3'

Sequencing Primer
(F):5'- GAAGAGTTTTCTCTTTTCTCCTCAGG -3'
(R):5'- CTTGTCCTGGAGTAACTCAGAG -3'
Posted On2014-01-15