Incidental Mutation 'R1208:Ccl25'
ID100524
Institutional Source Beutler Lab
Gene Symbol Ccl25
Ensembl Gene ENSMUSG00000023235
Gene Namechemokine (C-C motif) ligand 25
SynonymsCKb15, Scya25, TECK
MMRRC Submission 039277-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.064) question?
Stock #R1208 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location4325210-4360020 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 4357631 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 199 (S199T)
Ref Sequence ENSEMBL: ENSMUSP00000120719 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024004] [ENSMUST00000110982] [ENSMUST00000127460] [ENSMUST00000136191] [ENSMUST00000155797]
Predicted Effect probably benign
Transcript: ENSMUST00000024004
AA Change: S115T

PolyPhen 2 Score 0.263 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000024004
Gene: ENSMUSG00000023235
AA Change: S115T

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
SCY 27 88 1.34e-5 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000110982
AA Change: S115T

PolyPhen 2 Score 0.917 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000106610
Gene: ENSMUSG00000023235
AA Change: S115T

DomainStartEndE-ValueType
SCY 27 88 1.34e-5 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000127460
AA Change: S199T

PolyPhen 2 Score 0.921 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000120719
Gene: ENSMUSG00000023235
AA Change: S199T

DomainStartEndE-ValueType
transmembrane domain 87 109 N/A INTRINSIC
SCY 111 172 1.34e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000136191
SMART Domains Protein: ENSMUSP00000117515
Gene: ENSMUSG00000023235

DomainStartEndE-ValueType
Pfam:IL8 23 66 2.3e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000155797
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208836
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 97.8%
  • 10x: 91.7%
  • 20x: 74.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This antimicrobial gene belongs to the subfamily of small cytokine CC genes. Cytokines are a family of secreted proteins involved in immunoregulatory and inflammatory processes. The CC cytokines are proteins characterized by two adjacent cysteines. The cytokine encoded by this gene displays chemotactic activity for dendritic cells, thymocytes, and activated macrophages but is inactive on peripheral blood lymphocytes and neutrophils. The product of this gene binds to chemokine receptor CCR9. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired accumulation of antigen-specific CD8+ T lymphocytes within both lamina propria and epithelium of the small intestine. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atp13a3 A T 16: 30,354,247 C271S probably benign Het
Cdh15 G C 8: 122,857,495 E112Q probably damaging Het
Cep104 A T 4: 153,985,379 D270V probably damaging Het
Dnah5 T A 15: 28,327,731 Y2084N probably damaging Het
Eftud2 A G 11: 102,864,766 V214A probably benign Het
Epb41l4b C T 4: 57,077,252 probably null Het
Fam129c A T 8: 71,600,475 T125S probably damaging Het
Gm8298 C T 3: 59,865,294 P73L probably benign Het
Golgb1 AAGAGAGAGAGAGAGA AAGAGAGAGAGAGA 16: 36,915,205 probably null Het
Gys2 A G 6: 142,450,467 probably null Het
Lig4 T C 8: 9,971,062 E906G probably damaging Het
Mast3 G A 8: 70,788,272 probably null Het
Mta2 G A 19: 8,951,017 R560H probably damaging Het
Myom2 T C 8: 15,084,631 L478P probably damaging Het
Neb A T 2: 52,303,900 L673* probably null Het
Olfr1260 G A 2: 89,978,492 C238Y probably damaging Het
Pdpk1 C A 17: 24,093,609 probably null Het
Perm1 T C 4: 156,217,002 M1T probably null Het
Pphln1 T C 15: 93,459,729 W162R probably damaging Het
Ppp1r13b A G 12: 111,844,905 V183A probably damaging Het
Recql5 T C 11: 115,893,156 K951E probably damaging Het
Slc25a25 T C 2: 32,417,425 E309G probably benign Het
Sycp2 A T 2: 178,356,628 I1033N possibly damaging Het
Tbpl2 A T 2: 24,094,771 N120K probably benign Het
Unc5b A T 10: 60,766,992 L876Q probably damaging Het
Usp9y T C Y: 1,356,282 T1140A probably benign Het
Vmn1r40 A G 6: 89,714,344 I48V probably benign Het
Zbbx T C 3: 75,037,992 I708V possibly damaging Het
Zfp318 AGAAGA AGAAGAGGAAGA 17: 46,412,520 probably benign Het
Other mutations in Ccl25
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02070:Ccl25 APN 8 4348700 intron probably benign
IGL02188:Ccl25 APN 8 4348552 intron probably benign
IGL03338:Ccl25 APN 8 4349898 intron probably benign
R0584:Ccl25 UTSW 8 4354085 splice site probably benign
R0613:Ccl25 UTSW 8 4349850 missense probably benign 0.42
R1208:Ccl25 UTSW 8 4357631 missense possibly damaging 0.92
R1413:Ccl25 UTSW 8 4353892 makesense probably null
R3844:Ccl25 UTSW 8 4354183 missense possibly damaging 0.86
R4279:Ccl25 UTSW 8 4349829 missense probably damaging 1.00
R4921:Ccl25 UTSW 8 4353913 missense possibly damaging 0.92
R7021:Ccl25 UTSW 8 4349641 intron probably benign
R7033:Ccl25 UTSW 8 4349641 intron probably benign
R7630:Ccl25 UTSW 8 4353955 missense probably damaging 1.00
R8317:Ccl25 UTSW 8 4354138 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GCTTTAAGCTCAGAAGAAACTGCCAC -3'
(R):5'- GTTCAGGGTATGACCAAAGTCCCG -3'

Sequencing Primer
(F):5'- tcgggaggcagaggcag -3'
(R):5'- GGGTAAGGCCCCTGTTCC -3'
Posted On2014-01-15