Incidental Mutation 'R1208:Mast3'
ID 100530
Institutional Source Beutler Lab
Gene Symbol Mast3
Ensembl Gene ENSMUSG00000031833
Gene Name microtubule associated serine/threonine kinase 3
Synonyms
MMRRC Submission 039277-MU
Accession Numbers

Ncbi RefSeq: NM_199308.2. MGI:2683541

Essential gene? Non essential (E-score: 0.000) question?
Stock # R1208 (G1)
Quality Score 126
Status Not validated
Chromosome 8
Chromosomal Location 70778117-70805054 bp(-) (GRCm38)
Type of Mutation splice site (626 bp from exon)
DNA Base Change (assembly) G to A at 70788272 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000148351 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000166004] [ENSMUST00000211948] [ENSMUST00000212001] [ENSMUST00000212038] [ENSMUST00000212551] [ENSMUST00000212673] [ENSMUST00000212757] [ENSMUST00000212875]
AlphaFold Q3U214
Predicted Effect possibly damaging
Transcript: ENSMUST00000166004
AA Change: A227V

PolyPhen 2 Score 0.903 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000128703
Gene: ENSMUSG00000031833
AA Change: A227V

DomainStartEndE-ValueType
low complexity region 43 59 N/A INTRINSIC
Pfam:DUF1908 64 337 4.4e-128 PFAM
S_TKc 373 646 2.77e-99 SMART
S_TK_X 647 710 2.39e-1 SMART
low complexity region 820 833 N/A INTRINSIC
low complexity region 910 942 N/A INTRINSIC
PDZ 958 1038 3.8e-15 SMART
low complexity region 1053 1074 N/A INTRINSIC
low complexity region 1089 1121 N/A INTRINSIC
low complexity region 1124 1150 N/A INTRINSIC
low complexity region 1180 1204 N/A INTRINSIC
low complexity region 1231 1248 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211841
Predicted Effect possibly damaging
Transcript: ENSMUST00000211948
AA Change: A211V

PolyPhen 2 Score 0.592 (Sensitivity: 0.87; Specificity: 0.91)
Predicted Effect probably null
Transcript: ENSMUST00000212001
Predicted Effect probably null
Transcript: ENSMUST00000212038
Predicted Effect probably benign
Transcript: ENSMUST00000212140
Predicted Effect probably null
Transcript: ENSMUST00000212551
Predicted Effect probably null
Transcript: ENSMUST00000212673
Predicted Effect probably null
Transcript: ENSMUST00000212757
Predicted Effect probably null
Transcript: ENSMUST00000212875
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 97.8%
  • 10x: 91.7%
  • 20x: 74.6%
Validation Efficiency
Allele List at MGI

All alleles(2) : Targeted(1) Gene trapped(1)

Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atp13a3 A T 16: 30,354,247 C271S probably benign Het
Ccl25 T A 8: 4,357,631 S199T possibly damaging Het
Cdh15 G C 8: 122,857,495 E112Q probably damaging Het
Cep104 A T 4: 153,985,379 D270V probably damaging Het
Dnah5 T A 15: 28,327,731 Y2084N probably damaging Het
Eftud2 A G 11: 102,864,766 V214A probably benign Het
Epb41l4b C T 4: 57,077,252 probably null Het
Fam129c A T 8: 71,600,475 T125S probably damaging Het
Gm8298 C T 3: 59,865,294 P73L probably benign Het
Golgb1 AAGAGAGAGAGAGAGA AAGAGAGAGAGAGA 16: 36,915,205 probably null Het
Gys2 A G 6: 142,450,467 probably null Het
Lig4 T C 8: 9,971,062 E906G probably damaging Het
Mta2 G A 19: 8,951,017 R560H probably damaging Het
Myom2 T C 8: 15,084,631 L478P probably damaging Het
Neb A T 2: 52,303,900 L673* probably null Het
Olfr1260 G A 2: 89,978,492 C238Y probably damaging Het
Pdpk1 C A 17: 24,093,609 probably null Het
Perm1 T C 4: 156,217,002 M1T probably null Het
Pphln1 T C 15: 93,459,729 W162R probably damaging Het
Ppp1r13b A G 12: 111,844,905 V183A probably damaging Het
Recql5 T C 11: 115,893,156 K951E probably damaging Het
Slc25a25 T C 2: 32,417,425 E309G probably benign Het
Sycp2 A T 2: 178,356,628 I1033N possibly damaging Het
Tbpl2 A T 2: 24,094,771 N120K probably benign Het
Unc5b A T 10: 60,766,992 L876Q probably damaging Het
Usp9y T C Y: 1,356,282 T1140A probably benign Het
Vmn1r40 A G 6: 89,714,344 I48V probably benign Het
Zbbx T C 3: 75,037,992 I708V possibly damaging Het
Zfp318 AGAAGA AGAAGAGGAAGA 17: 46,412,520 probably benign Het
Other mutations in Mast3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00952:Mast3 APN 8 70780683 splice site probably benign
IGL01411:Mast3 APN 8 70779583 missense possibly damaging 0.50
IGL01475:Mast3 APN 8 70779530 missense probably damaging 1.00
IGL01886:Mast3 APN 8 70782139 missense possibly damaging 0.94
IGL02104:Mast3 APN 8 70787906 missense possibly damaging 0.78
IGL02236:Mast3 APN 8 70789244 missense probably benign 0.36
IGL02437:Mast3 APN 8 70780558 missense possibly damaging 0.79
IGL02704:Mast3 APN 8 70786875 missense probably damaging 1.00
IGL03155:Mast3 APN 8 70789217 missense probably damaging 1.00
IGL03366:Mast3 APN 8 70781563 nonsense probably null
gravy UTSW 8 70786635 missense probably damaging 1.00
stuffing UTSW 8 70784797 frame shift probably null
turkey UTSW 8 70785482 missense probably damaging 1.00
BB010:Mast3 UTSW 8 70786635 missense probably damaging 1.00
BB020:Mast3 UTSW 8 70786635 missense probably damaging 1.00
R0037:Mast3 UTSW 8 70783699 critical splice donor site probably null
R0280:Mast3 UTSW 8 70783795 missense probably damaging 1.00
R0280:Mast3 UTSW 8 70787920 missense possibly damaging 0.65
R0731:Mast3 UTSW 8 70781321 missense probably damaging 1.00
R1101:Mast3 UTSW 8 70786663 missense probably damaging 1.00
R1177:Mast3 UTSW 8 70780324 missense probably damaging 1.00
R1208:Mast3 UTSW 8 70788272 splice site probably null
R1333:Mast3 UTSW 8 70781294 missense probably damaging 1.00
R1543:Mast3 UTSW 8 70792311 missense possibly damaging 0.93
R1544:Mast3 UTSW 8 70786172 missense probably damaging 1.00
R1738:Mast3 UTSW 8 70784556 missense probably benign 0.38
R1842:Mast3 UTSW 8 70780393 missense possibly damaging 0.91
R1936:Mast3 UTSW 8 70784800 missense probably damaging 1.00
R2015:Mast3 UTSW 8 70787363 missense probably benign 0.00
R2219:Mast3 UTSW 8 70780963 missense probably damaging 0.99
R2220:Mast3 UTSW 8 70780963 missense probably damaging 0.99
R3711:Mast3 UTSW 8 70779607 missense probably benign 0.13
R3919:Mast3 UTSW 8 70779422 missense probably benign 0.02
R4027:Mast3 UTSW 8 70787908 missense probably damaging 1.00
R4060:Mast3 UTSW 8 70781194 missense probably damaging 1.00
R4061:Mast3 UTSW 8 70781194 missense probably damaging 1.00
R4062:Mast3 UTSW 8 70781194 missense probably damaging 1.00
R4063:Mast3 UTSW 8 70781194 missense probably damaging 1.00
R4588:Mast3 UTSW 8 70780607 nonsense probably null
R4672:Mast3 UTSW 8 70784797 frame shift probably null
R4770:Mast3 UTSW 8 70786220 missense probably damaging 1.00
R4822:Mast3 UTSW 8 70780366 missense probably damaging 1.00
R4830:Mast3 UTSW 8 70788915 missense possibly damaging 0.87
R5196:Mast3 UTSW 8 70788245 missense probably damaging 1.00
R5333:Mast3 UTSW 8 70783501 missense probably benign 0.03
R5428:Mast3 UTSW 8 70784733 missense possibly damaging 0.95
R5656:Mast3 UTSW 8 70786221 missense probably damaging 1.00
R5920:Mast3 UTSW 8 70787933 missense probably benign 0.00
R6177:Mast3 UTSW 8 70790018 missense probably damaging 1.00
R6186:Mast3 UTSW 8 70785483 missense probably damaging 1.00
R6407:Mast3 UTSW 8 70782128 missense probably benign 0.02
R6614:Mast3 UTSW 8 70781966 missense possibly damaging 0.95
R6804:Mast3 UTSW 8 70786732 missense probably benign 0.29
R6873:Mast3 UTSW 8 70786592 nonsense probably null
R6930:Mast3 UTSW 8 70799471 nonsense probably null
R6948:Mast3 UTSW 8 70785482 missense probably damaging 1.00
R7084:Mast3 UTSW 8 70779473 missense probably benign 0.14
R7253:Mast3 UTSW 8 70789682 critical splice donor site probably null
R7316:Mast3 UTSW 8 70779788 missense probably damaging 1.00
R7357:Mast3 UTSW 8 70784859 missense probably damaging 1.00
R7405:Mast3 UTSW 8 70786171 missense probably damaging 1.00
R7429:Mast3 UTSW 8 70780303 missense probably damaging 1.00
R7430:Mast3 UTSW 8 70780303 missense probably damaging 1.00
R7521:Mast3 UTSW 8 70788768 missense probably benign 0.16
R7576:Mast3 UTSW 8 70781194 missense probably damaging 1.00
R7933:Mast3 UTSW 8 70786635 missense probably damaging 1.00
R7998:Mast3 UTSW 8 70783570 missense probably benign
R8021:Mast3 UTSW 8 70788252 missense probably benign 0.02
R8204:Mast3 UTSW 8 70788281 missense probably benign 0.00
R8327:Mast3 UTSW 8 70779418 missense probably damaging 1.00
R8357:Mast3 UTSW 8 70780441 missense probably benign 0.39
R8415:Mast3 UTSW 8 70781222 missense probably damaging 1.00
R8457:Mast3 UTSW 8 70780441 missense probably benign 0.39
R8530:Mast3 UTSW 8 70788233 missense possibly damaging 0.92
R8891:Mast3 UTSW 8 70781157 missense probably damaging 1.00
R8930:Mast3 UTSW 8 70781733 splice site probably benign
R9002:Mast3 UTSW 8 70781260 missense probably damaging 1.00
R9085:Mast3 UTSW 8 70796717 missense unknown
R9087:Mast3 UTSW 8 70789686 missense possibly damaging 0.93
R9148:Mast3 UTSW 8 70780447 missense probably damaging 0.98
R9364:Mast3 UTSW 8 70786182 missense probably damaging 1.00
R9779:Mast3 UTSW 8 70785483 missense probably damaging 1.00
Z1177:Mast3 UTSW 8 70789038 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- TGATGAGCAGCTTTCGGACCAG -3'
(R):5'- CCAGCTCTGATCAATGCTGTCAGTC -3'

Sequencing Primer
(F):5'- AGCTGCACTATGAAGCCC -3'
(R):5'- GTCCTGTCTGACGATAGCC -3'
Posted On 2014-01-15