Incidental Mutation 'R1208:Pphln1'
ID100551
Institutional Source Beutler Lab
Gene Symbol Pphln1
Ensembl Gene ENSMUSG00000036167
Gene Nameperiphilin 1
SynonymsCR, 1600022A19Rik, 1110063K05Rik
MMRRC Submission 039277-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1208 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location93398350-93491510 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 93459729 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 162 (W162R)
Ref Sequence ENSEMBL: ENSMUSP00000154876 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049122] [ENSMUST00000068457] [ENSMUST00000109256] [ENSMUST00000165935] [ENSMUST00000229071]
Predicted Effect probably damaging
Transcript: ENSMUST00000049122
AA Change: W250R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000042762
Gene: ENSMUSG00000036167
AA Change: W250R

DomainStartEndE-ValueType
low complexity region 35 59 N/A INTRINSIC
low complexity region 154 174 N/A INTRINSIC
low complexity region 215 231 N/A INTRINSIC
Pfam:Lge1 275 365 2.4e-20 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000068457
AA Change: W181R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000068165
Gene: ENSMUSG00000036167
AA Change: W181R

DomainStartEndE-ValueType
low complexity region 85 105 N/A INTRINSIC
low complexity region 146 162 N/A INTRINSIC
Pfam:Lge1 179 297 8.6e-19 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000109256
AA Change: W162R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000104879
Gene: ENSMUSG00000036167
AA Change: W162R

DomainStartEndE-ValueType
low complexity region 85 105 N/A INTRINSIC
low complexity region 127 143 N/A INTRINSIC
Pfam:Lge1 160 278 7.1e-19 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000165935
AA Change: W162R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000131121
Gene: ENSMUSG00000036167
AA Change: W162R

DomainStartEndE-ValueType
low complexity region 85 105 N/A INTRINSIC
low complexity region 127 143 N/A INTRINSIC
Pfam:Lge1 160 278 7.1e-19 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000229071
AA Change: W162R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 97.8%
  • 10x: 91.7%
  • 20x: 74.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is one of the several proteins that become sequentially incorporated into the cornified cell envelope during the terminal differentiation of keratinocyte at the outer layers of epidermis. This protein interacts with periplakin, which is known as a precursor of the cornified cell envelope. The cellular localization pattern and insolubility of this protein suggest that it may play a role in epithelial differentiation and contribute to epidermal integrity and barrier formation. Multiple alternatively spliced transcript variants encoding distinct isoforms have been observed. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trap allele die prior to E7.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atp13a3 A T 16: 30,354,247 C271S probably benign Het
Ccl25 T A 8: 4,357,631 S199T possibly damaging Het
Cdh15 G C 8: 122,857,495 E112Q probably damaging Het
Cep104 A T 4: 153,985,379 D270V probably damaging Het
Dnah5 T A 15: 28,327,731 Y2084N probably damaging Het
Eftud2 A G 11: 102,864,766 V214A probably benign Het
Epb41l4b C T 4: 57,077,252 probably null Het
Fam129c A T 8: 71,600,475 T125S probably damaging Het
Gm8298 C T 3: 59,865,294 P73L probably benign Het
Golgb1 AAGAGAGAGAGAGAGA AAGAGAGAGAGAGA 16: 36,915,205 probably null Het
Gys2 A G 6: 142,450,467 probably null Het
Lig4 T C 8: 9,971,062 E906G probably damaging Het
Mast3 G A 8: 70,788,272 probably null Het
Mta2 G A 19: 8,951,017 R560H probably damaging Het
Myom2 T C 8: 15,084,631 L478P probably damaging Het
Neb A T 2: 52,303,900 L673* probably null Het
Olfr1260 G A 2: 89,978,492 C238Y probably damaging Het
Pdpk1 C A 17: 24,093,609 probably null Het
Perm1 T C 4: 156,217,002 M1T probably null Het
Ppp1r13b A G 12: 111,844,905 V183A probably damaging Het
Recql5 T C 11: 115,893,156 K951E probably damaging Het
Slc25a25 T C 2: 32,417,425 E309G probably benign Het
Sycp2 A T 2: 178,356,628 I1033N possibly damaging Het
Tbpl2 A T 2: 24,094,771 N120K probably benign Het
Unc5b A T 10: 60,766,992 L876Q probably damaging Het
Usp9y T C Y: 1,356,282 T1140A probably benign Het
Vmn1r40 A G 6: 89,714,344 I48V probably benign Het
Zbbx T C 3: 75,037,992 I708V possibly damaging Het
Zfp318 AGAAGA AGAAGAGGAAGA 17: 46,412,520 probably benign Het
Other mutations in Pphln1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00338:Pphln1 APN 15 93465210 missense probably damaging 1.00
IGL01305:Pphln1 APN 15 93489104 missense probably damaging 1.00
IGL01651:Pphln1 APN 15 93488983 missense probably damaging 1.00
IGL03219:Pphln1 APN 15 93465255 splice site probably benign
ANU22:Pphln1 UTSW 15 93489104 missense probably damaging 1.00
R0294:Pphln1 UTSW 15 93420290 missense probably damaging 1.00
R0309:Pphln1 UTSW 15 93441707 missense possibly damaging 0.55
R0645:Pphln1 UTSW 15 93420311 missense possibly damaging 0.80
R1208:Pphln1 UTSW 15 93459729 missense probably damaging 1.00
R1879:Pphln1 UTSW 15 93424046 missense probably damaging 0.99
R1936:Pphln1 UTSW 15 93488987 missense possibly damaging 0.79
R4049:Pphln1 UTSW 15 93465106 missense probably damaging 0.99
R5034:Pphln1 UTSW 15 93452129 missense probably benign
R5472:Pphln1 UTSW 15 93488975 missense possibly damaging 0.89
R5945:Pphln1 UTSW 15 93455532 critical splice donor site probably null
R7116:Pphln1 UTSW 15 93455525 missense probably benign 0.10
R8239:Pphln1 UTSW 15 93489049 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- AGCCTTAGGTTAAAGGGCCTGGCA -3'
(R):5'- TATTCCCCAAGCACACGCCGAGGTA -3'

Sequencing Primer
(F):5'- TAAAGGGCCTGGCACTTTC -3'
(R):5'- ctgatgatgacctctgcctg -3'
Posted On2014-01-15