Mutagenetix > Incidental Mutation

Incidental Mutation 'R1208:Golgb1'

100555

Institutional Source

Beutler Lab

Gene Symbol

Golgb1

Ensembl Gene

ENSMUSG00000034243

Gene Name

golgi autoantigen, golgin subfamily b, macrogolgin 1

Synonyms

Giantin, C130074L01Rik, F730017E11Rik, Gm6840, 6330407A06Rik

MMRRC Submission

039277-MU

Accession Numbers

Genbank: NM_030035.1

Essential gene?

Probably essential (E-score: 0.911) question?

Stock #

R1208 (G1)

Quality Score

106

Status

Not validated

Chromosome

Chromosomal Location

36875140-36933085 bp(+) (GRCm38)

Type of Mutation

frame shift

DNA Base Change (assembly)

AAGAGAGAGAGAGAGA to AAGAGAGAGAGAGA at 36915205 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000110460 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000039855] [ENSMUST00000114812]

AlphaFold

no structure available at present

Predicted Effect

probably null
Transcript: ENSMUST00000039855

SMART Domains

Protein: ENSMUSP00000045239
Gene: ENSMUSG00000034243

Domain	Start	End	E-Value	Type
internal_repeat_2	24	61	7.47e-6	PROSPERO
low complexity region	87	107	N/A	INTRINSIC
coiled coil region	130	219	N/A	INTRINSIC
low complexity region	491	512	N/A	INTRINSIC
internal_repeat_3	519	558	7.47e-6	PROSPERO
coiled coil region	563	594	N/A	INTRINSIC
internal_repeat_4	627	661	3.38e-5	PROSPERO
coiled coil region	679	1121	N/A	INTRINSIC
coiled coil region	1153	1240	N/A	INTRINSIC
internal_repeat_4	1253	1288	3.38e-5	PROSPERO
low complexity region	1300	1314	N/A	INTRINSIC
internal_repeat_1	1321	1352	3.51e-6	PROSPERO
low complexity region	1357	1369	N/A	INTRINSIC
coiled coil region	1402	1755	N/A	INTRINSIC
internal_repeat_2	1760	1798	7.47e-6	PROSPERO
internal_repeat_3	1761	1804	7.47e-6	PROSPERO
coiled coil region	1818	2034	N/A	INTRINSIC
low complexity region	2291	2306	N/A	INTRINSIC
internal_repeat_1	2351	2382	3.51e-6	PROSPERO
low complexity region	2400	2418	N/A	INTRINSIC
low complexity region	2538	2549	N/A	INTRINSIC
coiled coil region	2775	2827	N/A	INTRINSIC
coiled coil region	2854	2943	N/A	INTRINSIC
low complexity region	2964	2976	N/A	INTRINSIC
coiled coil region	3007	3057	N/A	INTRINSIC
coiled coil region	3117	3163	N/A	INTRINSIC
transmembrane domain	3215	3237	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000114812

SMART Domains

Protein: ENSMUSP00000110460
Gene: ENSMUSG00000034243

Domain	Start	End	E-Value	Type
internal_repeat_2	24	61	6.71e-6	PROSPERO
low complexity region	87	107	N/A	INTRINSIC
low complexity region	120	134	N/A	INTRINSIC
low complexity region	143	154	N/A	INTRINSIC
low complexity region	200	219	N/A	INTRINSIC
low complexity region	450	471	N/A	INTRINSIC
internal_repeat_3	478	517	6.71e-6	PROSPERO
coiled coil region	522	553	N/A	INTRINSIC
internal_repeat_4	586	620	3.05e-5	PROSPERO
coiled coil region	638	1080	N/A	INTRINSIC
coiled coil region	1112	1199	N/A	INTRINSIC
internal_repeat_4	1212	1247	3.05e-5	PROSPERO
low complexity region	1259	1273	N/A	INTRINSIC
internal_repeat_1	1280	1311	3.14e-6	PROSPERO
low complexity region	1316	1328	N/A	INTRINSIC
coiled coil region	1361	1714	N/A	INTRINSIC
internal_repeat_2	1719	1757	6.71e-6	PROSPERO
internal_repeat_3	1720	1763	6.71e-6	PROSPERO
coiled coil region	1777	1993	N/A	INTRINSIC
low complexity region	2250	2265	N/A	INTRINSIC
internal_repeat_1	2310	2341	3.14e-6	PROSPERO
low complexity region	2359	2377	N/A	INTRINSIC
low complexity region	2497	2508	N/A	INTRINSIC
coiled coil region	2734	2786	N/A	INTRINSIC
coiled coil region	2813	2902	N/A	INTRINSIC
low complexity region	2923	2935	N/A	INTRINSIC
coiled coil region	2966	3016	N/A	INTRINSIC
coiled coil region	3076	3122	N/A	INTRINSIC
transmembrane domain	3174	3196	N/A	INTRINSIC

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.3%
3x: 97.8%
10x: 91.7%
20x: 74.6%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Homozygous knockout affects glycosylation of glycoproteins in the extra-cellular matrix of the palatal shelves, resulting in their failure to elevate and fuse, leading to cleft palate. [provided by MGI curators]

Allele List at MGI

All alleles(7) : Targeted, other(2) Gene trapped(5)

Other mutations in this stock

Total: 29 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Atp13a3	A	T	16: 30,354,247	C271S	probably benign	Het
Ccl25	T	A	8: 4,357,631	S199T	possibly damaging	Het
Cdh15	G	C	8: 122,857,495	E112Q	probably damaging	Het
Cep104	A	T	4: 153,985,379	D270V	probably damaging	Het
Dnah5	T	A	15: 28,327,731	Y2084N	probably damaging	Het
Eftud2	A	G	11: 102,864,766	V214A	probably benign	Het
Epb41l4b	C	T	4: 57,077,252		probably null	Het
Fam129c	A	T	8: 71,600,475	T125S	probably damaging	Het
Gm8298	C	T	3: 59,865,294	P73L	probably benign	Het
Gys2	A	G	6: 142,450,467		probably null	Het
Lig4	T	C	8: 9,971,062	E906G	probably damaging	Het
Mast3	G	A	8: 70,788,272		probably null	Het
Mta2	G	A	19: 8,951,017	R560H	probably damaging	Het
Myom2	T	C	8: 15,084,631	L478P	probably damaging	Het
Neb	A	T	2: 52,303,900	L673*	probably null	Het
Olfr1260	G	A	2: 89,978,492	C238Y	probably damaging	Het
Pdpk1	C	A	17: 24,093,609		probably null	Het
Perm1	T	C	4: 156,217,002	M1T	probably null	Het
Pphln1	T	C	15: 93,459,729	W162R	probably damaging	Het
Ppp1r13b	A	G	12: 111,844,905	V183A	probably damaging	Het
Recql5	T	C	11: 115,893,156	K951E	probably damaging	Het
Slc25a25	T	C	2: 32,417,425	E309G	probably benign	Het
Sycp2	A	T	2: 178,356,628	I1033N	possibly damaging	Het
Tbpl2	A	T	2: 24,094,771	N120K	probably benign	Het
Unc5b	A	T	10: 60,766,992	L876Q	probably damaging	Het
Usp9y	T	C	Y: 1,356,282	T1140A	probably benign	Het
Vmn1r40	A	G	6: 89,714,344	I48V	probably benign	Het
Zbbx	T	C	3: 75,037,992	I708V	possibly damaging	Het
Zfp318	AGAAGA	AGAAGAGGAAGA	17: 46,412,520		probably benign	Het

Other mutations in Golgb1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01394:Golgb1	APN	16	36931564	missense	probably damaging	1.00
IGL01717:Golgb1	APN	16	36915502	nonsense	probably null
IGL01965:Golgb1	APN	16	36917920	missense	probably damaging	1.00
IGL02128:Golgb1	APN	16	36916304	missense	probably damaging	1.00
IGL02268:Golgb1	APN	16	36913128	missense	probably benign	0.25
IGL02383:Golgb1	APN	16	36886200	missense	probably benign	0.01
IGL02444:Golgb1	APN	16	36907816	splice site	probably benign
IGL02635:Golgb1	APN	16	36915013	missense	probably benign	0.00
IGL02655:Golgb1	APN	16	36918080	missense	probably damaging	0.98
IGL02887:Golgb1	APN	16	36925849	missense	probably damaging	0.99
IGL02937:Golgb1	APN	16	36916210	missense	probably damaging	1.00
IGL02973:Golgb1	APN	16	36912080	missense	possibly damaging	0.92
IGL02982:Golgb1	APN	16	36925810	missense	probably damaging	0.98
IGL03065:Golgb1	APN	16	36912866	missense	probably benign	0.11
IGL03109:Golgb1	APN	16	36915611	missense	possibly damaging	0.93
IGL03323:Golgb1	APN	16	36913453	nonsense	probably null
I2288:Golgb1	UTSW	16	36898542	missense	probably benign	0.00
I2289:Golgb1	UTSW	16	36898542	missense	probably benign	0.00
R0071:Golgb1	UTSW	16	36915503	missense	probably benign	0.00
R0071:Golgb1	UTSW	16	36915503	missense	probably benign	0.00
R0080:Golgb1	UTSW	16	36898611	missense	probably damaging	1.00
R0102:Golgb1	UTSW	16	36875468	intron	probably benign
R0242:Golgb1	UTSW	16	36875630	nonsense	probably null
R0242:Golgb1	UTSW	16	36875630	nonsense	probably null
R0276:Golgb1	UTSW	16	36913876	missense	probably damaging	1.00
R0394:Golgb1	UTSW	16	36875579	intron	probably benign
R0469:Golgb1	UTSW	16	36931635	missense	probably benign	0.41
R0522:Golgb1	UTSW	16	36915205	frame shift	probably null
R0575:Golgb1	UTSW	16	36918809	missense	probably benign
R0600:Golgb1	UTSW	16	36916271	missense	probably damaging	1.00
R0608:Golgb1	UTSW	16	36916330	nonsense	probably null
R0711:Golgb1	UTSW	16	36918790	missense	probably damaging	1.00
R0785:Golgb1	UTSW	16	36898790	missense	possibly damaging	0.95
R0893:Golgb1	UTSW	16	36912277	missense	possibly damaging	0.64
R1163:Golgb1	UTSW	16	36916126	missense	possibly damaging	0.50
R1315:Golgb1	UTSW	16	36914900	missense	probably benign	0.40
R1429:Golgb1	UTSW	16	36900563	missense	possibly damaging	0.93
R1505:Golgb1	UTSW	16	36919643	missense	possibly damaging	0.79
R1537:Golgb1	UTSW	16	36898788	missense	possibly damaging	0.89
R1610:Golgb1	UTSW	16	36926101	missense	probably benign	0.25
R1659:Golgb1	UTSW	16	36887617	missense	probably benign	0.01
R1769:Golgb1	UTSW	16	36916001	missense	probably damaging	1.00
R2105:Golgb1	UTSW	16	36914664	missense	probably benign
R2212:Golgb1	UTSW	16	36887347	missense	probably damaging	1.00
R2261:Golgb1	UTSW	16	36893360	missense	probably damaging	1.00
R2352:Golgb1	UTSW	16	36898559	missense	probably damaging	0.99
R2357:Golgb1	UTSW	16	36912008	missense	probably damaging	1.00
R2400:Golgb1	UTSW	16	36918466	missense	possibly damaging	0.62
R2513:Golgb1	UTSW	16	36915151	missense	possibly damaging	0.73
R3103:Golgb1	UTSW	16	36894849	missense	probably damaging	1.00
R3413:Golgb1	UTSW	16	36887347	missense	probably damaging	1.00
R3748:Golgb1	UTSW	16	36918912	missense	probably benign	0.00
R3847:Golgb1	UTSW	16	36898733	missense	probably benign	0.00
R3850:Golgb1	UTSW	16	36898733	missense	probably benign	0.00
R3936:Golgb1	UTSW	16	36914056	nonsense	probably null
R3975:Golgb1	UTSW	16	36918571	missense	probably damaging	0.99
R4025:Golgb1	UTSW	16	36915344	missense	probably benign	0.00
R4369:Golgb1	UTSW	16	36916907	missense	probably damaging	1.00
R4518:Golgb1	UTSW	16	36929263	missense	probably damaging	0.98
R4600:Golgb1	UTSW	16	36918625	missense	probably damaging	1.00
R4610:Golgb1	UTSW	16	36918625	missense	probably damaging	1.00
R4660:Golgb1	UTSW	16	36887618	missense	probably damaging	0.99
R4811:Golgb1	UTSW	16	36891419	missense	probably damaging	1.00
R4815:Golgb1	UTSW	16	36913115	missense	possibly damaging	0.79
R4835:Golgb1	UTSW	16	36891407	missense	possibly damaging	0.86
R4904:Golgb1	UTSW	16	36893386	missense	probably damaging	1.00
R4916:Golgb1	UTSW	16	36916118	missense	probably benign	0.05
R5121:Golgb1	UTSW	16	36919258	missense	probably damaging	0.99
R5133:Golgb1	UTSW	16	36891457	missense	possibly damaging	0.75
R5143:Golgb1	UTSW	16	36898689	missense	probably benign	0.09
R5185:Golgb1	UTSW	16	36875141	unclassified	probably benign
R5188:Golgb1	UTSW	16	36918465	missense	probably benign	0.13
R5260:Golgb1	UTSW	16	36913141	missense	probably benign	0.00
R5297:Golgb1	UTSW	16	36875616	intron	probably benign
R5386:Golgb1	UTSW	16	36912315	nonsense	probably null
R5438:Golgb1	UTSW	16	36900508	missense	probably benign	0.15
R5439:Golgb1	UTSW	16	36900508	missense	probably benign	0.15
R5494:Golgb1	UTSW	16	36928683	missense	possibly damaging	0.67
R5592:Golgb1	UTSW	16	36925763	missense	probably benign	0.02
R5740:Golgb1	UTSW	16	36919000	missense	probably damaging	0.99
R5862:Golgb1	UTSW	16	36926091	splice site	silent
R5928:Golgb1	UTSW	16	36911987	missense	probably damaging	1.00
R6009:Golgb1	UTSW	16	36914959	missense	probably damaging	1.00
R6062:Golgb1	UTSW	16	36914671	missense	possibly damaging	0.89
R6102:Golgb1	UTSW	16	36912865	missense	probably damaging	1.00
R6198:Golgb1	UTSW	16	36893395	missense	probably damaging	1.00
R6253:Golgb1	UTSW	16	36915622	missense	possibly damaging	0.77
R6254:Golgb1	UTSW	16	36913978	missense	probably damaging	0.99
R6321:Golgb1	UTSW	16	36918197	nonsense	probably null
R6700:Golgb1	UTSW	16	36875584	intron	probably benign
R6870:Golgb1	UTSW	16	36918203	missense	probably damaging	1.00
R6882:Golgb1	UTSW	16	36913990	missense	probably benign
R6944:Golgb1	UTSW	16	36912113	missense	probably benign
R7108:Golgb1	UTSW	16	36913721	missense	probably benign	0.01
R7124:Golgb1	UTSW	16	36913673	missense	probably benign	0.01
R7125:Golgb1	UTSW	16	36917963	missense	possibly damaging	0.85
R7187:Golgb1	UTSW	16	36916150	missense	probably benign	0.43
R7205:Golgb1	UTSW	16	36875301	missense	unknown
R7206:Golgb1	UTSW	16	36913749	missense	probably benign	0.41
R7233:Golgb1	UTSW	16	36914758	missense	possibly damaging	0.91
R7320:Golgb1	UTSW	16	36915951	nonsense	probably null
R7367:Golgb1	UTSW	16	36898546	missense	probably benign	0.00
R7408:Golgb1	UTSW	16	36898547	missense	probably damaging	0.98
R7419:Golgb1	UTSW	16	36912919	missense	possibly damaging	0.95
R7556:Golgb1	UTSW	16	36915793	missense	probably benign	0.03
R7599:Golgb1	UTSW	16	36875396	missense	unknown
R7673:Golgb1	UTSW	16	36913669	missense	probably benign	0.05
R7789:Golgb1	UTSW	16	36875399	missense	unknown
R7792:Golgb1	UTSW	16	36918730	missense	probably benign	0.43
R7830:Golgb1	UTSW	16	36898721	missense	possibly damaging	0.93
R7847:Golgb1	UTSW	16	36931920	missense	probably damaging	1.00
R7905:Golgb1	UTSW	16	36913685	missense	probably benign
R7944:Golgb1	UTSW	16	36914104	missense	probably benign	0.02
R7945:Golgb1	UTSW	16	36914104	missense	probably benign	0.02
R7950:Golgb1	UTSW	16	36915424	missense	probably benign	0.13
R8040:Golgb1	UTSW	16	36913479	missense	possibly damaging	0.85
R8077:Golgb1	UTSW	16	36918633	missense	probably damaging	0.99
R8181:Golgb1	UTSW	16	36916830	missense	probably damaging	1.00
R8370:Golgb1	UTSW	16	36912317	missense	probably benign	0.00
R8684:Golgb1	UTSW	16	36914402	missense	possibly damaging	0.92
R8725:Golgb1	UTSW	16	36919201	missense	probably damaging	1.00
R8727:Golgb1	UTSW	16	36919201	missense	probably damaging	1.00
R8738:Golgb1	UTSW	16	36916313	missense	probably damaging	1.00
R8785:Golgb1	UTSW	16	36919744	missense	probably damaging	0.99
R8824:Golgb1	UTSW	16	36915689	missense	probably benign
R8825:Golgb1	UTSW	16	36919447	missense	probably benign	0.00
R8940:Golgb1	UTSW	16	36916397	missense	probably damaging	1.00
R8962:Golgb1	UTSW	16	36913616	missense	probably damaging	1.00
R9245:Golgb1	UTSW	16	36918819	nonsense	probably null
R9365:Golgb1	UTSW	16	36915762	missense	probably damaging	1.00
R9612:Golgb1	UTSW	16	36919605	missense	probably benign	0.41
R9620:Golgb1	UTSW	16	36919449	missense	probably benign
R9691:Golgb1	UTSW	16	36898634	missense	probably damaging	1.00
R9747:Golgb1	UTSW	16	36893407	missense	probably damaging	1.00
V1662:Golgb1	UTSW	16	36898542	missense	probably benign	0.00
X0067:Golgb1	UTSW	16	36914303	nonsense	probably null
Z1088:Golgb1	UTSW	16	36919742	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGCGAAAGCCTGAAACTAGCTCTG -3'
(R):5'- AGCGTCCTTCTCCGCCATTAAAG -3'

Sequencing Primer
(F):5'- TCCGTGAGAAGTTCTAAGATGGC -3'
(R):5'- CCTTAGAAAGGGTTTTATGCTCC -3'

Posted On

2014-01-15