Incidental Mutation 'R1209:Olfr53'
ID100593
Institutional Source Beutler Lab
Gene Symbol Olfr53
Ensembl Gene ENSMUSG00000094819
Gene Nameolfactory receptor 53
SynonymsGA_x6K02T2PBJ9-42798103-42799038, IE12, MOR253-5
MMRRC Submission 039278-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.112) question?
Stock #R1209 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location140646452-140653085 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 140652014 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 12 (T12A)
Ref Sequence ENSEMBL: ENSMUSP00000148158 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084456] [ENSMUST00000211057] [ENSMUST00000211399]
Predicted Effect probably benign
Transcript: ENSMUST00000084456
AA Change: T12A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000081494
Gene: ENSMUSG00000094819
AA Change: T12A

DomainStartEndE-ValueType
Pfam:7tm_4 33 309 6.5e-51 PFAM
Pfam:7TM_GPCR_Srsx 37 208 9.7e-7 PFAM
Pfam:7tm_1 43 292 1.6e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000211057
AA Change: T12A

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
Predicted Effect probably benign
Transcript: ENSMUST00000211399
AA Change: T12A

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 97.8%
  • 10x: 94.2%
  • 20x: 85.9%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010111I01Rik A G 13: 63,191,064 probably null Het
Ahi1 A G 10: 20,963,730 D180G probably damaging Het
Banp G A 8: 121,975,917 V30I possibly damaging Het
Btn2a2 C T 13: 23,480,566 probably null Het
Cdh15 G C 8: 122,857,495 E112Q probably damaging Het
Cdhr1 C T 14: 37,082,942 probably null Het
Cfap44 T C 16: 44,422,417 I728T possibly damaging Het
Fbn2 A G 18: 58,070,016 M1212T probably benign Het
Fmo3 C T 1: 162,964,028 D227N probably benign Het
Klk5 G T 7: 43,846,998 R118L probably damaging Het
Krtap4-1 A G 11: 99,628,157 V9A unknown Het
Muc5b A G 7: 141,857,910 N1531S unknown Het
Mypn A G 10: 63,118,499 S1234P probably damaging Het
Nme5 A G 18: 34,569,896 L113S probably damaging Het
Olfr1275 T C 2: 111,231,613 Y60C probably damaging Het
Oprk1 T C 1: 5,602,261 V207A probably benign Het
Otop2 A G 11: 115,324,643 E130G possibly damaging Het
Pard6a A G 8: 105,702,391 K78R probably benign Het
Pbrm1 T A 14: 31,118,852 L1637H probably damaging Het
Rims4 C T 2: 163,863,929 V262M possibly damaging Het
Rnaset2b T A 17: 6,979,076 C27S probably benign Het
Rps24 A G 14: 24,491,762 T6A probably damaging Het
Speer4a T C 5: 26,035,125 probably null Het
Srsf4 A G 4: 131,901,059 probably benign Het
Syt11 G A 3: 88,747,840 R79C probably damaging Het
Tbx3 T C 5: 119,680,953 V531A probably benign Het
Tmem132d T A 5: 127,784,870 D729V probably damaging Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Other mutations in Olfr53
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01017:Olfr53 APN 7 140652476 missense probably benign 0.00
IGL01071:Olfr53 APN 7 140652914 missense possibly damaging 0.76
IGL02590:Olfr53 APN 7 140652392 unclassified probably null
IGL02694:Olfr53 APN 7 140652180 missense probably damaging 0.99
R0071:Olfr53 UTSW 7 140652257 missense probably benign 0.00
R0071:Olfr53 UTSW 7 140652257 missense probably benign 0.00
R0089:Olfr53 UTSW 7 140652311 missense probably damaging 0.99
R0586:Olfr53 UTSW 7 140652063 missense probably benign 0.35
R1491:Olfr53 UTSW 7 140652737 missense probably damaging 1.00
R1781:Olfr53 UTSW 7 140652506 missense probably damaging 0.99
R4060:Olfr53 UTSW 7 140652120 missense probably damaging 1.00
R4231:Olfr53 UTSW 7 140652740 missense probably damaging 1.00
R4236:Olfr53 UTSW 7 140652740 missense probably damaging 1.00
R4299:Olfr53 UTSW 7 140652243 missense probably benign 0.00
R4398:Olfr53 UTSW 7 140652828 missense possibly damaging 0.65
R4675:Olfr53 UTSW 7 140652161 missense probably damaging 1.00
R4937:Olfr53 UTSW 7 140652621 missense probably benign 0.00
R5854:Olfr53 UTSW 7 140652578 missense probably benign 0.03
R6124:Olfr53 UTSW 7 140652594 missense probably damaging 1.00
R7092:Olfr53 UTSW 7 140652237 missense probably benign 0.16
R7167:Olfr53 UTSW 7 140652553 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CAGAGCACAGGGCTTAGTAGCAATG -3'
(R):5'- CACACAATATCCGTGGTAGCCAGG -3'

Sequencing Primer
(F):5'- GAGTAAAGAATGCTTCTCTCTTTCCG -3'
(R):5'- TGGTAGCCAGGTTGCACAG -3'
Posted On2014-01-15