Incidental Mutation 'R1210:Eef1b2'
ID100631
Institutional Source Beutler Lab
Gene Symbol Eef1b2
Ensembl Gene ENSMUSG00000025967
Gene Nameeukaryotic translation elongation factor 1 beta 2
Synonyms
MMRRC Submission 039279-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1210 (G1)
Quality Score132
Status Not validated
Chromosome1
Chromosomal Location63176825-63180486 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 63177273 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 21 (D21G)
Ref Sequence ENSEMBL: ENSMUSP00000133545 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027108] [ENSMUST00000027111] [ENSMUST00000129339] [ENSMUST00000135877] [ENSMUST00000142062] [ENSMUST00000168099] [ENSMUST00000174890] [ENSMUST00000188524] [ENSMUST00000185412] [ENSMUST00000185732] [ENSMUST00000185847] [ENSMUST00000188370] [ENSMUST00000189664]
Predicted Effect possibly damaging
Transcript: ENSMUST00000027108
AA Change: D21G

PolyPhen 2 Score 0.904 (Sensitivity: 0.82; Specificity: 0.94)
Predicted Effect probably benign
Transcript: ENSMUST00000027111
SMART Domains Protein: ENSMUSP00000027111
Gene: ENSMUSG00000025968

DomainStartEndE-ValueType
Pfam:Fer2_4 29 107 8.5e-20 PFAM
Pfam:Fer2 34 97 1e-11 PFAM
NADH-G_4Fe-4S_3 113 153 6.5e-19 SMART
Pfam:Molybdopterin 301 629 1e-76 PFAM
Pfam:NADH_dhqG_C 658 710 1.5e-19 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000082668
Predicted Effect noncoding transcript
Transcript: ENSMUST00000082678
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126469
Predicted Effect unknown
Transcript: ENSMUST00000126795
AA Change: D17G
SMART Domains Protein: ENSMUSP00000134341
Gene: ENSMUSG00000025967
AA Change: D17G

DomainStartEndE-ValueType
SCOP:d1aw9_1 4 62 8e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000129339
AA Change: D21G

PolyPhen 2 Score 0.186 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000116492
Gene: ENSMUSG00000025967
AA Change: D21G

DomainStartEndE-ValueType
EF-1_beta_acid 103 130 2.53e-4 SMART
EF1_GNE 139 225 3.86e-44 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000135877
SMART Domains Protein: ENSMUSP00000137671
Gene: ENSMUSG00000025967

DomainStartEndE-ValueType
transmembrane domain 38 57 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140612
Predicted Effect probably damaging
Transcript: ENSMUST00000142062
AA Change: D21G

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148553
Predicted Effect probably benign
Transcript: ENSMUST00000168099
SMART Domains Protein: ENSMUSP00000126621
Gene: ENSMUSG00000025968

DomainStartEndE-ValueType
Pfam:Fer2_4 29 107 4.3e-19 PFAM
Pfam:Fer2 34 97 1e-11 PFAM
NADH-G_4Fe-4S_3 113 153 6.5e-19 SMART
Pfam:Molybdopterin 301 629 1e-76 PFAM
Pfam:DUF1982 657 710 3.6e-18 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000174890
AA Change: D21G

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000133545
Gene: ENSMUSG00000025967
AA Change: D21G

DomainStartEndE-ValueType
Blast:WHEP 3 64 3e-6 BLAST
SCOP:d1aw9_1 7 65 2e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184516
Predicted Effect probably damaging
Transcript: ENSMUST00000188524
AA Change: D21G

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000140895
Gene: ENSMUSG00000025967
AA Change: D21G

DomainStartEndE-ValueType
EF-1_beta_acid 62 89 1.2e-8 SMART
EF1_GNE 98 184 2.9e-48 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185827
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199062
Predicted Effect probably benign
Transcript: ENSMUST00000185412
SMART Domains Protein: ENSMUSP00000140467
Gene: ENSMUSG00000025968

DomainStartEndE-ValueType
Pfam:Fer2_4 29 79 5.3e-10 PFAM
Pfam:Fer2 34 79 1.4e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000185732
SMART Domains Protein: ENSMUSP00000140307
Gene: ENSMUSG00000025968

DomainStartEndE-ValueType
Pfam:Fer2_4 29 107 4.4e-18 PFAM
Pfam:Fer2 34 97 6.2e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000185847
SMART Domains Protein: ENSMUSP00000141190
Gene: ENSMUSG00000025968

DomainStartEndE-ValueType
Pfam:Molybdopterin 1 60 5.7e-5 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000188370
SMART Domains Protein: ENSMUSP00000139664
Gene: ENSMUSG00000025968

DomainStartEndE-ValueType
Pfam:Fer2_4 29 96 1.1e-13 PFAM
Pfam:Fer2 34 127 1.2e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000189664
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 97.8%
  • 10x: 93.9%
  • 20x: 83.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a translation elongation factor. The protein is a guanine nucleotide exchange factor involved in the transfer of aminoacylated tRNAs to the ribosome. Alternative splicing results in three transcript variants which differ only in the 5' UTR. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 21 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Cdh15 G C 8: 122,857,495 E112Q probably damaging Het
Clec7a T C 6: 129,465,525 I180V probably damaging Het
Csf3 A G 11: 98,702,477 D140G probably damaging Het
Cwf19l2 T C 9: 3,430,810 S381P probably benign Het
Fam83a A T 15: 57,995,248 Y228F possibly damaging Het
Gm5422 A G 10: 31,250,723 noncoding transcript Het
Itga5 A G 15: 103,357,473 V149A possibly damaging Het
Lrrfip1 A G 1: 91,115,193 H440R probably benign Het
Mfsd13a C T 19: 46,366,504 T40I probably benign Het
Mindy4 T A 6: 55,284,813 L569H possibly damaging Het
Mme A G 3: 63,343,606 K356R probably benign Het
Nfkb1 A G 3: 135,594,927 I626T probably benign Het
Olfr1186 G C 2: 88,526,276 R231P possibly damaging Het
Olfr172 T C 16: 58,761,050 N42S probably damaging Het
Olfr38 T C 6: 42,762,667 V205A possibly damaging Het
Olfr720 T C 14: 14,176,029 T18A probably benign Het
Rock2 T A 12: 16,965,469 V789D probably damaging Het
Sav1 A G 12: 69,969,179 Y282H probably damaging Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Vmn2r89 T C 14: 51,454,970 F77L probably benign Het
Vps50 G A 6: 3,594,884 V816I probably damaging Het
Other mutations in Eef1b2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00852:Eef1b2 APN 1 63178506 missense probably damaging 1.00
IGL00861:Eef1b2 APN 1 63178506 missense probably damaging 1.00
IGL00862:Eef1b2 APN 1 63178506 missense probably damaging 1.00
IGL00863:Eef1b2 APN 1 63178506 missense probably damaging 1.00
IGL01642:Eef1b2 APN 1 63177831 missense probably damaging 1.00
R1127:Eef1b2 UTSW 1 63179457 critical splice acceptor site probably null
R1909:Eef1b2 UTSW 1 63177272 missense probably damaging 0.99
R2045:Eef1b2 UTSW 1 63179487 nonsense probably null
R5129:Eef1b2 UTSW 1 63179580 missense probably damaging 0.96
R6847:Eef1b2 UTSW 1 63178489 missense probably benign 0.32
R7748:Eef1b2 UTSW 1 63177865 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GGAACGGACCTTGACCTTTAACCTC -3'
(R):5'- ACTTGTCCAAAGACGCGGAAGAAC -3'

Sequencing Primer
(F):5'- GGAAACGCCTCCGTCTCTATATAAG -3'
(R):5'- ACGGAGAGCAAGCATCATC -3'
Posted On2014-01-15