Incidental Mutation 'R1210:Mindy4'
ID100646
Institutional Source Beutler Lab
Gene Symbol Mindy4
Ensembl Gene ENSMUSG00000038022
Gene NameMINDY lysine 48 deubiquitinase 4
SynonymsC330043M08Rik, LOC384387, Fam188b
MMRRC Submission 039279-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.089) question?
Stock #R1210 (G1)
Quality Score172
Status Not validated
Chromosome6
Chromosomal Location55203383-55320222 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 55284813 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Histidine at position 569 (L569H)
Ref Sequence ENSEMBL: ENSMUSP00000061221 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053094]
Predicted Effect possibly damaging
Transcript: ENSMUST00000053094
AA Change: L569H

PolyPhen 2 Score 0.917 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000061221
Gene: ENSMUSG00000038022
AA Change: L569H

DomainStartEndE-ValueType
low complexity region 154 166 N/A INTRINSIC
low complexity region 224 240 N/A INTRINSIC
low complexity region 265 277 N/A INTRINSIC
DUF4205 403 739 1.47e-187 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203225
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 97.8%
  • 10x: 93.9%
  • 20x: 83.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 21 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Cdh15 G C 8: 122,857,495 E112Q probably damaging Het
Clec7a T C 6: 129,465,525 I180V probably damaging Het
Csf3 A G 11: 98,702,477 D140G probably damaging Het
Cwf19l2 T C 9: 3,430,810 S381P probably benign Het
Eef1b2 A G 1: 63,177,273 D21G probably damaging Het
Fam83a A T 15: 57,995,248 Y228F possibly damaging Het
Gm5422 A G 10: 31,250,723 noncoding transcript Het
Itga5 A G 15: 103,357,473 V149A possibly damaging Het
Lrrfip1 A G 1: 91,115,193 H440R probably benign Het
Mfsd13a C T 19: 46,366,504 T40I probably benign Het
Mme A G 3: 63,343,606 K356R probably benign Het
Nfkb1 A G 3: 135,594,927 I626T probably benign Het
Olfr1186 G C 2: 88,526,276 R231P possibly damaging Het
Olfr172 T C 16: 58,761,050 N42S probably damaging Het
Olfr38 T C 6: 42,762,667 V205A possibly damaging Het
Olfr720 T C 14: 14,176,029 T18A probably benign Het
Rock2 T A 12: 16,965,469 V789D probably damaging Het
Sav1 A G 12: 69,969,179 Y282H probably damaging Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Vmn2r89 T C 14: 51,454,970 F77L probably benign Het
Vps50 G A 6: 3,594,884 V816I probably damaging Het
Other mutations in Mindy4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01098:Mindy4 APN 6 55284742 splice site probably benign
IGL01483:Mindy4 APN 6 55216685 missense probably damaging 1.00
IGL01721:Mindy4 APN 6 55223999 missense probably damaging 1.00
IGL01965:Mindy4 APN 6 55260532 splice site probably benign
IGL02214:Mindy4 APN 6 55216651 missense possibly damaging 0.88
IGL03058:Mindy4 APN 6 55308198 missense probably damaging 1.00
IGL03077:Mindy4 APN 6 55309330 missense probably damaging 1.00
IGL03296:Mindy4 APN 6 55297753 critical splice donor site probably null
R0383:Mindy4 UTSW 6 55276634 missense probably benign 0.00
R0384:Mindy4 UTSW 6 55216684 missense probably damaging 1.00
R0636:Mindy4 UTSW 6 55276585 missense possibly damaging 0.73
R0848:Mindy4 UTSW 6 55318286 nonsense probably null
R1171:Mindy4 UTSW 6 55255616 missense possibly damaging 0.75
R1341:Mindy4 UTSW 6 55255616 missense probably benign 0.00
R2030:Mindy4 UTSW 6 55211262 missense probably damaging 1.00
R2127:Mindy4 UTSW 6 55218265 missense probably benign 0.05
R2237:Mindy4 UTSW 6 55301070 missense probably damaging 1.00
R2238:Mindy4 UTSW 6 55301070 missense probably damaging 1.00
R2250:Mindy4 UTSW 6 55300949 missense probably damaging 0.99
R2571:Mindy4 UTSW 6 55284785 missense probably damaging 1.00
R2846:Mindy4 UTSW 6 55278100 missense probably damaging 1.00
R3001:Mindy4 UTSW 6 55218364 missense probably benign 0.21
R3002:Mindy4 UTSW 6 55218364 missense probably benign 0.21
R3498:Mindy4 UTSW 6 55216525 missense probably benign 0.01
R4167:Mindy4 UTSW 6 55224346 missense possibly damaging 0.93
R4767:Mindy4 UTSW 6 55260565 missense probably damaging 0.98
R4812:Mindy4 UTSW 6 55279103 missense possibly damaging 0.64
R5109:Mindy4 UTSW 6 55216745 splice site probably null
R5203:Mindy4 UTSW 6 55255661 missense probably benign 0.00
R5221:Mindy4 UTSW 6 55224107 missense probably benign
R5628:Mindy4 UTSW 6 55260594 missense probably damaging 0.98
R6265:Mindy4 UTSW 6 55301064 missense probably damaging 0.99
R6596:Mindy4 UTSW 6 55224016 missense probably damaging 0.99
R7084:Mindy4 UTSW 6 55278235 missense probably benign
R7350:Mindy4 UTSW 6 55301025 missense probably damaging 0.97
R7535:Mindy4 UTSW 6 55297753 critical splice donor site probably null
R7625:Mindy4 UTSW 6 55276613 missense possibly damaging 0.95
R8052:Mindy4 UTSW 6 55300992 missense probably damaging 0.99
X0065:Mindy4 UTSW 6 55262816 missense probably damaging 0.99
Z1177:Mindy4 UTSW 6 55224341 missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- TGACTCCTGTGACTGTGCTGGAAG -3'
(R):5'- TGCTGGGTTCCCTAATGGCAAC -3'

Sequencing Primer
(F):5'- ACTGTGCTGGAAGCCGTG -3'
(R):5'- AGTTGCCTGCAAGGTCTC -3'
Posted On2014-01-15