Incidental Mutation 'R1163:Egfr'
ID100653
Institutional Source Beutler Lab
Gene Symbol Egfr
Ensembl Gene ENSMUSG00000020122
Gene Nameepidermal growth factor receptor
Synonymsavian erythroblastic leukemia viral (v-erb-b) oncogene homolog, Wa5, 9030024J15Rik, Erbb, Errb1
MMRRC Submission 039236-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.904) question?
Stock #R1163 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location16752203-16918158 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 16883546 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 605 (T605S)
Ref Sequence ENSEMBL: ENSMUSP00000099948 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020329] [ENSMUST00000102884] [ENSMUST00000125984]
Predicted Effect probably benign
Transcript: ENSMUST00000020329
AA Change: T605S

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000020329
Gene: ENSMUSG00000020122
AA Change: T605S

DomainStartEndE-ValueType
low complexity region 5 25 N/A INTRINSIC
Pfam:Recep_L_domain 57 168 1.4e-32 PFAM
low complexity region 182 195 N/A INTRINSIC
FU 228 270 6.07e-4 SMART
Pfam:Recep_L_domain 361 481 1.8e-29 PFAM
FU 496 547 8.25e-6 SMART
FU 552 601 4.38e-10 SMART
FU 614 654 4.05e1 SMART
low complexity region 677 694 N/A INTRINSIC
TyrKc 714 970 2.88e-129 SMART
low complexity region 1004 1017 N/A INTRINSIC
low complexity region 1027 1048 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000102884
AA Change: T605S

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000099948
Gene: ENSMUSG00000020122
AA Change: T605S

DomainStartEndE-ValueType
low complexity region 5 25 N/A INTRINSIC
Pfam:Recep_L_domain 57 168 5e-33 PFAM
low complexity region 182 195 N/A INTRINSIC
FU 228 270 6.07e-4 SMART
Pfam:Recep_L_domain 361 481 2e-29 PFAM
FU 496 547 8.25e-6 SMART
FU 552 601 4.38e-10 SMART
FU 614 654 4.54e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000125984
AA Change: T98S

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000122632
Gene: ENSMUSG00000020122
AA Change: T98S

DomainStartEndE-ValueType
FU 1 40 2.55e0 SMART
FU 45 94 4.38e-10 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a transmembrane glycoprotein that is a member of the protein kinase superfamily. This protein is a receptor for members of the epidermal growth factor family. EGFR is a cell surface protein that binds to epidermal growth factor. Binding of the protein to a ligand induces receptor dimerization and tyrosine autophosphorylation and leads to cell proliferation. Mutations in this gene are associated with lung cancer. [provided by RefSeq, Jun 2016]
PHENOTYPE: Mutations widely affect epithelial development. Null homozygote survival is strain dependent, with defects observed in skin, eye, brain, viscera, palate, tongue and other tisses. Other mutations produce an open eyed, curly whisker phenotype, while a dominant hypermorph yields a thickened epidermis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700113H08Rik T A 10: 87,121,422 Y7N probably damaging Het
4930579F01Rik T G 3: 138,176,510 D18A probably damaging Het
Abca8a T C 11: 110,071,530 D499G probably benign Het
Adamts1 G C 16: 85,802,637 A25G probably benign Het
Adamts2 A T 11: 50,779,714 I552F probably damaging Het
Akap3 A G 6: 126,864,787 D123G probably damaging Het
Ankar C T 1: 72,688,705 V350I possibly damaging Het
Apob A G 12: 8,011,654 T3379A probably damaging Het
Ash1l G T 3: 89,035,263 probably null Het
Atp2b1 T C 10: 98,979,851 I119T possibly damaging Het
B3gnt2 A T 11: 22,836,558 M210K probably benign Het
Bcl11a A G 11: 24,165,143 N829D probably benign Het
Btnl4 T C 17: 34,470,075 E337G possibly damaging Het
Casr A T 16: 36,494,807 V967D probably damaging Het
Cd200 A T 16: 45,392,352 V244D probably damaging Het
Cd200r4 A G 16: 44,838,020 N256D probably benign Het
Cep68 A G 11: 20,240,539 S158P probably damaging Het
Chst10 A T 1: 38,871,702 V123D probably damaging Het
Cobll1 T C 2: 65,098,279 H938R probably damaging Het
Creld2 G A 15: 88,820,631 W103* probably null Het
Dmkn T G 7: 30,765,051 C205G probably damaging Het
Dock8 A G 19: 25,051,503 I24V probably benign Het
Dpp3 C T 19: 4,914,923 W488* probably null Het
Dpp9 C A 17: 56,199,426 A365S possibly damaging Het
Eme2 G A 17: 24,892,918 S263F probably damaging Het
Fam83g T C 11: 61,703,436 S599P probably damaging Het
Fscn1 G T 5: 142,960,843 W132L probably damaging Het
Gbp2b A G 3: 142,599,096 T98A probably damaging Het
Gm13088 A G 4: 143,656,634 L5P probably damaging Het
Gm4922 C T 10: 18,783,721 A418T possibly damaging Het
Golgb1 G T 16: 36,916,126 V1912L possibly damaging Het
Gon4l T C 3: 88,892,535 L829P probably damaging Het
Grm3 T A 5: 9,570,738 I169L probably benign Het
Gsdma2 A G 11: 98,650,858 D137G probably damaging Het
Hhip T C 8: 79,992,476 Y474C probably damaging Het
Hsph1 A T 5: 149,630,801 V163E probably damaging Het
Ifi203 T C 1: 173,924,137 K373E probably damaging Het
Itsn2 A G 12: 4,712,009 T1540A probably benign Het
Kdm1b T C 13: 47,071,922 V527A probably benign Het
Kdm5d G A Y: 898,029 A22T probably benign Het
Khdrbs1 A T 4: 129,725,586 F254Y possibly damaging Het
Kif26a T C 12: 112,179,945 F1822L probably benign Het
Krt1 C A 15: 101,848,165 E308* probably null Het
Lrrc47 T A 4: 154,011,817 M1K probably null Het
Mrgpra4 A T 7: 47,981,476 W126R probably damaging Het
Nlrp4e G A 7: 23,320,972 V295I probably benign Het
Olfr1100 A G 2: 86,978,676 L40P probably damaging Het
Olfr1258 G T 2: 89,930,105 V99F possibly damaging Het
Olfr1446 T A 19: 12,890,149 T143S probably benign Het
Olfr201 A G 16: 59,269,155 S171P probably benign Het
Olfr206 A T 16: 59,345,062 I213N probably damaging Het
Olfr228 A T 2: 86,483,238 F168Y probably damaging Het
Olfr364-ps1 A T 2: 37,147,027 T272S probably damaging Het
Olfr453 G A 6: 42,744,123 V29I probably benign Het
Olfr798 A G 10: 129,625,647 V138A possibly damaging Het
Plec G T 15: 76,183,838 N1190K possibly damaging Het
Plin1 T C 7: 79,729,971 T44A probably damaging Het
Pou3f2 TTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG TTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG 4: 22,487,697 probably benign Het
Psg27 A G 7: 18,565,309 L29P probably damaging Het
Psmd13 C A 7: 140,897,454 T292N probably damaging Het
Rab1b A T 19: 5,104,656 Y88* probably null Het
Reln T A 5: 21,899,029 I3315L probably benign Het
Rmdn2 A T 17: 79,659,451 M257L probably benign Het
Rnd1 A T 15: 98,676,554 F47L probably damaging Het
Rnf41 G A 10: 128,438,207 V243I probably benign Het
Rnf43 C G 11: 87,729,513 S226R probably damaging Het
Scn5a A T 9: 119,533,927 D542E probably damaging Het
Sema5b A T 16: 35,628,096 I81F probably benign Het
Serinc5 G A 13: 92,682,777 C73Y probably damaging Het
Serpina3g A T 12: 104,239,292 N97Y possibly damaging Het
Shq1 A G 6: 100,637,072 S262P probably damaging Het
Smad4 A T 18: 73,648,907 I428N probably damaging Het
Snip1 G T 4: 125,072,820 G348W probably damaging Het
Spg11 A G 2: 122,070,941 L1506P probably damaging Het
Stard9 G A 2: 120,696,213 V984I possibly damaging Het
Svopl A T 6: 38,029,700 F121I possibly damaging Het
Tjp1 A T 7: 65,323,054 V546E probably damaging Het
Tmem116 T A 5: 121,493,756 F110L probably damaging Het
Ttyh2 C T 11: 114,710,888 T446M probably benign Het
Tubb1 A T 2: 174,457,739 I405L probably benign Het
Uba5 A T 9: 104,055,826 F155L possibly damaging Het
Ubd C T 17: 37,195,321 H33Y probably damaging Het
Ube2cbp A T 9: 86,440,595 D175E probably benign Het
Usp24 A G 4: 106,420,960 Q2293R probably benign Het
Vmn1r175 T A 7: 23,808,512 H230L probably benign Het
Vmn1r88 A G 7: 13,178,133 I139V probably benign Het
Vmn2r1 T C 3: 64,086,625 F131L probably benign Het
Yipf3 T C 17: 46,251,229 probably null Het
Zdhhc19 A G 16: 32,506,440 K192R probably benign Het
Zfy1 G A Y: 725,611 T718I probably damaging Het
Other mutations in Egfr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01338:Egfr APN 11 16863020 missense probably damaging 1.00
IGL01529:Egfr APN 11 16863014 missense probably benign
IGL01556:Egfr APN 11 16905382 missense probably damaging 1.00
IGL02627:Egfr APN 11 16869346 missense probably damaging 1.00
IGL02862:Egfr APN 11 16883562 missense probably benign 0.25
IGL02945:Egfr APN 11 16752514 missense probably damaging 1.00
IGL02994:Egfr APN 11 16911811 missense probably damaging 1.00
IGL03395:Egfr APN 11 16910261 splice site probably benign
set UTSW 11 16871881 splice site probably benign
Velvet UTSW 11 16904399 missense probably damaging 1.00
PIT1430001:Egfr UTSW 11 16910214 missense probably benign 0.00
R0196:Egfr UTSW 11 16911746 missense probably benign 0.02
R0513:Egfr UTSW 11 16872855 missense probably damaging 1.00
R0567:Egfr UTSW 11 16872873 missense probably benign 0.01
R0629:Egfr UTSW 11 16869333 missense probably damaging 1.00
R0961:Egfr UTSW 11 16862964 missense probably damaging 1.00
R1454:Egfr UTSW 11 16889920 missense probably benign
R1456:Egfr UTSW 11 16863065 missense probably benign 0.00
R1503:Egfr UTSW 11 16869301 missense possibly damaging 0.86
R1577:Egfr UTSW 11 16869241 missense probably benign 0.04
R1595:Egfr UTSW 11 16906847 missense probably damaging 0.99
R1699:Egfr UTSW 11 16859019 missense probably benign 0.14
R2172:Egfr UTSW 11 16911562 missense probably benign 0.00
R3690:Egfr UTSW 11 16871881 splice site probably benign
R3922:Egfr UTSW 11 16881495 missense probably damaging 1.00
R4444:Egfr UTSW 11 16871027 missense probably benign 0.00
R4685:Egfr UTSW 11 16858980 missense probably damaging 1.00
R4737:Egfr UTSW 11 16869231 missense probably damaging 0.99
R4814:Egfr UTSW 11 16869354 missense probably damaging 1.00
R4841:Egfr UTSW 11 16911607 missense probably benign 0.05
R4842:Egfr UTSW 11 16911607 missense probably benign 0.05
R4903:Egfr UTSW 11 16908949 missense probably damaging 1.00
R4964:Egfr UTSW 11 16908949 missense probably damaging 1.00
R4985:Egfr UTSW 11 16859029 nonsense probably null
R4998:Egfr UTSW 11 16881493 missense possibly damaging 0.58
R5001:Egfr UTSW 11 16904434 missense probably damaging 0.98
R5304:Egfr UTSW 11 16884260 missense probably benign
R5309:Egfr UTSW 11 16911703 missense probably benign 0.00
R5653:Egfr UTSW 11 16911617 missense probably benign 0.04
R5905:Egfr UTSW 11 16911494 missense probably damaging 1.00
R6051:Egfr UTSW 11 16883607 missense possibly damaging 0.87
R6052:Egfr UTSW 11 16911554 missense probably benign 0.16
R6114:Egfr UTSW 11 16904374 missense possibly damaging 0.46
R6261:Egfr UTSW 11 16889964 missense probably benign 0.11
R6434:Egfr UTSW 11 16869294 missense probably benign 0.25
R6475:Egfr UTSW 11 16891259 missense probably benign
R6799:Egfr UTSW 11 16896952 missense probably damaging 1.00
R7143:Egfr UTSW 11 16871627 missense probably benign 0.20
R7195:Egfr UTSW 11 16868162 missense probably damaging 1.00
R7459:Egfr UTSW 11 16896967 missense probably damaging 1.00
R7612:Egfr UTSW 11 16859025 missense possibly damaging 0.74
R7757:Egfr UTSW 11 16889966 missense possibly damaging 0.64
R7763:Egfr UTSW 11 16891266 missense probably damaging 1.00
Z1177:Egfr UTSW 11 16862954 missense probably benign 0.05
Z1177:Egfr UTSW 11 16869319 missense probably damaging 1.00
Predicted Primers
Posted On2014-01-15