Incidental Mutation 'R1210:Fam83a'
ID100668
Institutional Source Beutler Lab
Gene Symbol Fam83a
Ensembl Gene ENSMUSG00000051225
Gene Namefamily with sequence similarity 83, member A
Synonyms
MMRRC Submission 039279-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.055) question?
Stock #R1210 (G1)
Quality Score206
Status Not validated
Chromosome15
Chromosomal Location57985419-58011009 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 57995248 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 228 (Y228F)
Ref Sequence ENSEMBL: ENSMUSP00000125464 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050374] [ENSMUST00000160942]
Predicted Effect possibly damaging
Transcript: ENSMUST00000050374
AA Change: Y228F

PolyPhen 2 Score 0.952 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000050051
Gene: ENSMUSG00000051225
AA Change: Y228F

DomainStartEndE-ValueType
Pfam:DUF1669 14 258 6e-85 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000160942
AA Change: Y228F

PolyPhen 2 Score 0.952 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000125464
Gene: ENSMUSG00000051225
AA Change: Y228F

DomainStartEndE-ValueType
Pfam:DUF1669 19 295 3.6e-102 PFAM
low complexity region 350 361 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 97.8%
  • 10x: 93.9%
  • 20x: 83.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 21 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Cdh15 G C 8: 122,857,495 E112Q probably damaging Het
Clec7a T C 6: 129,465,525 I180V probably damaging Het
Csf3 A G 11: 98,702,477 D140G probably damaging Het
Cwf19l2 T C 9: 3,430,810 S381P probably benign Het
Eef1b2 A G 1: 63,177,273 D21G probably damaging Het
Gm5422 A G 10: 31,250,723 noncoding transcript Het
Itga5 A G 15: 103,357,473 V149A possibly damaging Het
Lrrfip1 A G 1: 91,115,193 H440R probably benign Het
Mfsd13a C T 19: 46,366,504 T40I probably benign Het
Mindy4 T A 6: 55,284,813 L569H possibly damaging Het
Mme A G 3: 63,343,606 K356R probably benign Het
Nfkb1 A G 3: 135,594,927 I626T probably benign Het
Olfr1186 G C 2: 88,526,276 R231P possibly damaging Het
Olfr172 T C 16: 58,761,050 N42S probably damaging Het
Olfr38 T C 6: 42,762,667 V205A possibly damaging Het
Olfr720 T C 14: 14,176,029 T18A probably benign Het
Rock2 T A 12: 16,965,469 V789D probably damaging Het
Sav1 A G 12: 69,969,179 Y282H probably damaging Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Vmn2r89 T C 14: 51,454,970 F77L probably benign Het
Vps50 G A 6: 3,594,884 V816I probably damaging Het
Other mutations in Fam83a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01061:Fam83a APN 15 57986375 missense possibly damaging 0.91
IGL01328:Fam83a APN 15 57986505 missense probably damaging 1.00
IGL01590:Fam83a APN 15 58009777 missense probably damaging 1.00
IGL02306:Fam83a APN 15 57995308 missense probably damaging 1.00
IGL03062:Fam83a APN 15 57993077 splice site probably null
R0110:Fam83a UTSW 15 58009926 missense probably benign 0.09
R0450:Fam83a UTSW 15 58009926 missense probably benign 0.09
R0469:Fam83a UTSW 15 58009926 missense probably benign 0.09
R0533:Fam83a UTSW 15 58009811 missense probably benign 0.43
R1386:Fam83a UTSW 15 57986503 missense probably damaging 1.00
R1474:Fam83a UTSW 15 58009876 missense probably benign 0.02
R1476:Fam83a UTSW 15 58009945 missense probably benign 0.00
R1969:Fam83a UTSW 15 57986102 missense probably damaging 1.00
R4463:Fam83a UTSW 15 57995259 missense probably damaging 1.00
R5088:Fam83a UTSW 15 58009800 missense probably benign 0.00
R5961:Fam83a UTSW 15 58009596 missense possibly damaging 0.90
R6307:Fam83a UTSW 15 57986111 missense possibly damaging 0.93
R6524:Fam83a UTSW 15 57995340 critical splice donor site probably null
R6676:Fam83a UTSW 15 57993043 missense possibly damaging 0.91
R7412:Fam83a UTSW 15 57986425 missense probably benign
R7447:Fam83a UTSW 15 58009690 missense probably benign 0.00
R7493:Fam83a UTSW 15 57986173 missense probably damaging 1.00
X0023:Fam83a UTSW 15 58009605 missense possibly damaging 0.72
Predicted Primers PCR Primer
(F):5'- AGATAAAACCTTCGTGAGCATCCTTCC -3'
(R):5'- AAGGGGCCACATTTCTCACTTCTG -3'

Sequencing Primer
(F):5'- cagaccaggtggcgtataag -3'
(R):5'- CACTTCTGGCTTCGTTTATTTGG -3'
Posted On2014-01-15