Incidental Mutation 'R1210:Itga5'
ID 100670
Institutional Source Beutler Lab
Gene Symbol Itga5
Ensembl Gene ENSMUSG00000000555
Gene Name integrin alpha 5 (fibronectin receptor alpha)
Synonyms Fnra, Cd49e
MMRRC Submission 039279-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R1210 (G1)
Quality Score 207
Status Not validated
Chromosome 15
Chromosomal Location 103252713-103275190 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 103265900 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 149 (V149A)
Ref Sequence ENSEMBL: ENSMUSP00000023128 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023128] [ENSMUST00000215331]
AlphaFold P11688
Predicted Effect possibly damaging
Transcript: ENSMUST00000023128
AA Change: V149A

PolyPhen 2 Score 0.765 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000023128
Gene: ENSMUSG00000000555
AA Change: V149A

DomainStartEndE-ValueType
low complexity region 17 40 N/A INTRINSIC
Int_alpha 59 118 2.27e-8 SMART
Int_alpha 271 321 9.6e-7 SMART
Int_alpha 325 387 1.03e-15 SMART
Int_alpha 391 447 4.17e-16 SMART
Int_alpha 455 511 1.49e-3 SMART
SCOP:d1m1xa2 651 789 3e-44 SMART
SCOP:d1m1xa3 792 992 1e-62 SMART
transmembrane domain 1003 1025 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000215331
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230460
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 97.8%
  • 10x: 93.9%
  • 20x: 83.8%
Validation Efficiency
MGI Phenotype FUNCTION: The product of this gene belongs to the integrin alpha chain family. Integrins are heterodimeric integral membrane proteins composed of an alpha chain and a beta chain. This gene encodes the integrin alpha 5 chain, which is proteolytically processed to generate light and heavy chains that join with beta 1 to form a fibronectin receptor. In addition to adhesion, integrins are known to participate in cell-surface mediated signaling. Integrin alpha 5 and integrin alpha V chains are produced by distinct genes. Homozygous knockout mice for this gene exhibit embryonic lethality. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit severe defects in posterior trunk and yolk sac mesodermal structures, lack of epithelialization of somites, reduced numbers of Schwann cells, and lethality around embryonic day 10-11. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 21 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Cdh15 G C 8: 123,584,234 (GRCm39) E112Q probably damaging Het
Clec7a T C 6: 129,442,488 (GRCm39) I180V probably damaging Het
Csf3 A G 11: 98,593,303 (GRCm39) D140G probably damaging Het
Cwf19l2 T C 9: 3,430,810 (GRCm39) S381P probably benign Het
Eef1b2 A G 1: 63,216,432 (GRCm39) D21G probably damaging Het
Fam83a A T 15: 57,858,644 (GRCm39) Y228F possibly damaging Het
Gm5422 A G 10: 31,126,719 (GRCm39) noncoding transcript Het
Lrrfip1 A G 1: 91,042,915 (GRCm39) H440R probably benign Het
Mfsd13a C T 19: 46,354,943 (GRCm39) T40I probably benign Het
Mindy4 T A 6: 55,261,798 (GRCm39) L569H possibly damaging Het
Mme A G 3: 63,251,027 (GRCm39) K356R probably benign Het
Nfkb1 A G 3: 135,300,688 (GRCm39) I626T probably benign Het
Or2f1b T C 6: 42,739,601 (GRCm39) V205A possibly damaging Het
Or2t6 T C 14: 14,176,029 (GRCm38) T18A probably benign Het
Or4c100 G C 2: 88,356,620 (GRCm39) R231P possibly damaging Het
Or5k1b T C 16: 58,581,413 (GRCm39) N42S probably damaging Het
Rock2 T A 12: 17,015,470 (GRCm39) V789D probably damaging Het
Sav1 A G 12: 70,015,953 (GRCm39) Y282H probably damaging Het
Ugcg C T 4: 59,207,798 (GRCm39) P46S probably benign Het
Vmn2r89 T C 14: 51,692,427 (GRCm39) F77L probably benign Het
Vps50 G A 6: 3,594,884 (GRCm39) V816I probably damaging Het
Other mutations in Itga5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00914:Itga5 APN 15 103,258,799 (GRCm39) critical splice donor site probably null
IGL01102:Itga5 APN 15 103,255,102 (GRCm39) missense probably benign 0.13
IGL01474:Itga5 APN 15 103,262,697 (GRCm39) nonsense probably null
IGL01768:Itga5 APN 15 103,259,997 (GRCm39) missense probably benign 0.34
IGL01832:Itga5 APN 15 103,264,376 (GRCm39) nonsense probably null
IGL02188:Itga5 APN 15 103,256,144 (GRCm39) missense probably benign 0.30
IGL02701:Itga5 APN 15 103,256,193 (GRCm39) missense probably damaging 0.98
IGL02838:Itga5 APN 15 103,260,036 (GRCm39) missense probably damaging 1.00
IGL02955:Itga5 APN 15 103,259,261 (GRCm39) missense possibly damaging 0.48
R0617:Itga5 UTSW 15 103,264,742 (GRCm39) critical splice donor site probably null
R0845:Itga5 UTSW 15 103,259,196 (GRCm39) missense probably benign 0.07
R1522:Itga5 UTSW 15 103,265,209 (GRCm39) nonsense probably null
R1576:Itga5 UTSW 15 103,260,044 (GRCm39) missense probably damaging 0.96
R1666:Itga5 UTSW 15 103,256,329 (GRCm39) missense probably benign 0.00
R1808:Itga5 UTSW 15 103,258,826 (GRCm39) missense probably damaging 1.00
R1836:Itga5 UTSW 15 103,254,441 (GRCm39) missense probably damaging 1.00
R1964:Itga5 UTSW 15 103,262,741 (GRCm39) missense probably damaging 1.00
R4290:Itga5 UTSW 15 103,260,684 (GRCm39) critical splice donor site probably null
R4458:Itga5 UTSW 15 103,258,630 (GRCm39) missense probably damaging 1.00
R4610:Itga5 UTSW 15 103,259,259 (GRCm39) missense probably damaging 1.00
R4676:Itga5 UTSW 15 103,265,637 (GRCm39) missense probably damaging 1.00
R4795:Itga5 UTSW 15 103,256,187 (GRCm39) missense probably benign 0.05
R4796:Itga5 UTSW 15 103,256,187 (GRCm39) missense probably benign 0.05
R4837:Itga5 UTSW 15 103,262,511 (GRCm39) missense probably damaging 0.99
R4929:Itga5 UTSW 15 103,261,662 (GRCm39) missense probably benign 0.42
R5896:Itga5 UTSW 15 103,259,514 (GRCm39) missense probably benign
R5947:Itga5 UTSW 15 103,265,212 (GRCm39) missense probably damaging 1.00
R5957:Itga5 UTSW 15 103,259,856 (GRCm39) missense probably benign 0.05
R6153:Itga5 UTSW 15 103,265,880 (GRCm39) missense probably damaging 1.00
R6353:Itga5 UTSW 15 103,260,950 (GRCm39) missense probably damaging 0.98
R6657:Itga5 UTSW 15 103,259,222 (GRCm39) missense probably damaging 1.00
R6698:Itga5 UTSW 15 103,259,808 (GRCm39) missense probably benign 0.15
R6891:Itga5 UTSW 15 103,265,970 (GRCm39) missense probably damaging 1.00
R6981:Itga5 UTSW 15 103,258,653 (GRCm39) missense probably benign 0.00
R7574:Itga5 UTSW 15 103,258,876 (GRCm39) missense probably damaging 1.00
R7762:Itga5 UTSW 15 103,258,184 (GRCm39) missense probably benign 0.01
R7813:Itga5 UTSW 15 103,265,741 (GRCm39) critical splice acceptor site probably null
R7984:Itga5 UTSW 15 103,264,379 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAATGGTCCACTACACTCTGGCAC -3'
(R):5'- ATGCTGAGCATCCTAGACCAAGGC -3'

Sequencing Primer
(F):5'- TGTGCGCCAGCTATACAGTG -3'
(R):5'- CTAGGGTCACCTTCCTGAGAAC -3'
Posted On 2014-01-15