Incidental Mutation 'R1210:Olfr172'
ID100672
Institutional Source Beutler Lab
Gene Symbol Olfr172
Ensembl Gene ENSMUSG00000071510
Gene Nameolfactory receptor 172
SynonymsGA_x54KRFPKG5P-54930346-54929417, MOR184-2
MMRRC Submission 039279-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock #R1210 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location58759544-58763176 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 58761050 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 42 (N42S)
Ref Sequence ENSEMBL: ENSMUSP00000150908 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095991] [ENSMUST00000214139]
Predicted Effect probably damaging
Transcript: ENSMUST00000095991
AA Change: N42S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000093690
Gene: ENSMUSG00000071510
AA Change: N42S

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 3.9e-52 PFAM
Pfam:7tm_1 41 290 3e-19 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000214139
AA Change: N42S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 97.8%
  • 10x: 93.9%
  • 20x: 83.8%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 21 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Cdh15 G C 8: 122,857,495 E112Q probably damaging Het
Clec7a T C 6: 129,465,525 I180V probably damaging Het
Csf3 A G 11: 98,702,477 D140G probably damaging Het
Cwf19l2 T C 9: 3,430,810 S381P probably benign Het
Eef1b2 A G 1: 63,177,273 D21G probably damaging Het
Fam83a A T 15: 57,995,248 Y228F possibly damaging Het
Gm5422 A G 10: 31,250,723 noncoding transcript Het
Itga5 A G 15: 103,357,473 V149A possibly damaging Het
Lrrfip1 A G 1: 91,115,193 H440R probably benign Het
Mfsd13a C T 19: 46,366,504 T40I probably benign Het
Mindy4 T A 6: 55,284,813 L569H possibly damaging Het
Mme A G 3: 63,343,606 K356R probably benign Het
Nfkb1 A G 3: 135,594,927 I626T probably benign Het
Olfr1186 G C 2: 88,526,276 R231P possibly damaging Het
Olfr38 T C 6: 42,762,667 V205A possibly damaging Het
Olfr720 T C 14: 14,176,029 T18A probably benign Het
Rock2 T A 12: 16,965,469 V789D probably damaging Het
Sav1 A G 12: 69,969,179 Y282H probably damaging Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Vmn2r89 T C 14: 51,454,970 F77L probably benign Het
Vps50 G A 6: 3,594,884 V816I probably damaging Het
Other mutations in Olfr172
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03006:Olfr172 APN 16 58761148 missense probably benign 0.01
R1521:Olfr172 UTSW 16 58760853 missense probably damaging 1.00
R1710:Olfr172 UTSW 16 58761141 missense probably benign 0.02
R4730:Olfr172 UTSW 16 58760742 missense probably benign 0.00
R4784:Olfr172 UTSW 16 58760548 missense probably damaging 1.00
R4924:Olfr172 UTSW 16 58760619 nonsense probably null
R5213:Olfr172 UTSW 16 58760621 missense probably damaging 1.00
R5967:Olfr172 UTSW 16 58760362 missense probably damaging 1.00
R7022:Olfr172 UTSW 16 58761119 missense probably benign 0.00
R7259:Olfr172 UTSW 16 58760505 missense possibly damaging 0.92
R7745:Olfr172 UTSW 16 58760419 nonsense probably null
R7983:Olfr172 UTSW 16 58761014 missense probably benign 0.37
R8123:Olfr172 UTSW 16 58761174 start codon destroyed possibly damaging 0.91
R8189:Olfr172 UTSW 16 58760925 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTCATAGGCCATTGCTGACAGGAG -3'
(R):5'- TGCTACAAAATGGGCATGAGTCCAG -3'

Sequencing Primer
(F):5'- TGCAGTTTCAACAGTGGACAG -3'
(R):5'- TCCTCCTTTGAACCAATGAGAG -3'
Posted On2014-01-15