Incidental Mutation 'R1211:Erlec1'
ID100697
Institutional Source Beutler Lab
Gene Symbol Erlec1
Ensembl Gene ENSMUSG00000020311
Gene Nameendoplasmic reticulum lectin 1
Synonyms4933407N01Rik
MMRRC Submission 039280-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1211 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location30930774-30954335 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 30948298 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000072929 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073192] [ENSMUST00000073192] [ENSMUST00000129593] [ENSMUST00000203878]
Predicted Effect probably null
Transcript: ENSMUST00000073192
SMART Domains Protein: ENSMUSP00000072929
Gene: ENSMUSG00000020311

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
Pfam:PRKCSH 111 199 6.6e-21 PFAM
Pfam:PRKCSH 342 421 2e-29 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000073192
SMART Domains Protein: ENSMUSP00000072929
Gene: ENSMUSG00000020311

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
Pfam:PRKCSH 111 199 6.6e-21 PFAM
Pfam:PRKCSH 342 421 2e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000129593
SMART Domains Protein: ENSMUSP00000129078
Gene: ENSMUSG00000020311

DomainStartEndE-ValueType
SCOP:d1c39a_ 2 52 1e-3 SMART
Pfam:PRKCSH 149 225 1.2e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000143126
SMART Domains Protein: ENSMUSP00000126490
Gene: ENSMUSG00000020311

DomainStartEndE-ValueType
Pfam:PRKCSH 52 80 2.3e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152770
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155304
Predicted Effect probably benign
Transcript: ENSMUST00000203878
SMART Domains Protein: ENSMUSP00000144900
Gene: ENSMUSG00000020305

DomainStartEndE-ValueType
low complexity region 20 36 N/A INTRINSIC
ANK 48 77 3.5e-2 SMART
ANK 81 110 8e-3 SMART
ANK 117 146 4.8e-5 SMART
ANK 150 179 1.7e-7 SMART
ANK 184 213 1.8e-4 SMART
ANK 217 246 1.8e-6 SMART
ANK 250 279 1.2e-7 SMART
ANK 285 315 1.1e0 SMART
ANK 318 347 1.2e-3 SMART
ANK 354 385 7.7e-1 SMART
SOCS 493 542 2.8e-4 SMART
SOCS_box 499 541 1.6e-17 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.2%
  • 10x: 95.3%
  • 20x: 89.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a resident endoplasmic reticulum (ER) protein that functions in N-glycan recognition. This protein is thought to be involved in ER-associated degradation via its interaction with the membrane-associated ubiquitin ligase complex. It also functions as a regulator of multiple cellular stress-response pathways in a manner that promotes metastatic cell survival. Alternative splicing results in multiple transcript variants. A related pseudogene has been identified on chromosome 21. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 15 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgra3 T C 5: 50,006,876 M254V possibly damaging Het
Arrdc3 A G 13: 80,890,698 T40A possibly damaging Het
Cntnap1 C A 11: 101,184,710 Q905K probably damaging Het
Dclk1 A G 3: 55,380,823 I256V probably benign Het
Dync1h1 G A 12: 110,636,509 E2195K probably benign Het
Gm10160 A T 7: 81,855,749 Y16N probably benign Het
Gm10608 C CNNNNNNNN 9: 119,160,712 probably null Het
H2-Bl A T 17: 36,081,073 V207D probably damaging Het
Kcna4 AGAGGAGGAGGAGGAGGAGG AGAGGAGGAGGAGGAGG 2: 107,295,315 probably benign Het
Mycbp2 A T 14: 103,120,563 D4488E probably benign Het
Ndufaf1 A G 2: 119,655,675 S319P probably damaging Het
Olfr193 A C 16: 59,110,160 V150G possibly damaging Het
Smad4 T C 18: 73,649,911 probably null Het
Spaca7 T C 8: 12,573,139 S12P probably damaging Het
Stx11 A G 10: 12,941,411 S190P probably damaging Het
Other mutations in Erlec1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00326:Erlec1 APN 11 30948510 missense possibly damaging 0.84
IGL00537:Erlec1 APN 11 30939591 missense probably benign 0.04
IGL00766:Erlec1 APN 11 30950623 nonsense probably null
IGL01760:Erlec1 APN 11 30934731 missense probably benign 0.34
IGL02505:Erlec1 APN 11 30950767 missense probably damaging 1.00
IGL02633:Erlec1 APN 11 30948430 nonsense probably null
R0674:Erlec1 UTSW 11 30935073 intron probably benign
R1974:Erlec1 UTSW 11 30939604 missense possibly damaging 0.83
R4326:Erlec1 UTSW 11 30949972 missense probably benign
R4328:Erlec1 UTSW 11 30949972 missense probably benign
R4392:Erlec1 UTSW 11 30943697 critical splice donor site probably null
R4641:Erlec1 UTSW 11 30948442 nonsense probably null
R4697:Erlec1 UTSW 11 30952640 missense probably benign 0.27
R4917:Erlec1 UTSW 11 30934710 missense possibly damaging 0.56
R5486:Erlec1 UTSW 11 30935047 missense probably damaging 0.98
R5735:Erlec1 UTSW 11 30950591 missense probably benign 0.00
R5775:Erlec1 UTSW 11 30943848 missense probably benign 0.11
R6475:Erlec1 UTSW 11 30948442 nonsense probably null
R7027:Erlec1 UTSW 11 30950790 missense probably damaging 1.00
R7235:Erlec1 UTSW 11 30950751 missense possibly damaging 0.91
R7440:Erlec1 UTSW 11 30950818 missense possibly damaging 0.66
Predicted Primers PCR Primer
(F):5'- TTTAAATGGAGAGCCCGGCAGTG -3'
(R):5'- CTTGGAAATCAGCCTTGAAACTCGC -3'

Sequencing Primer
(F):5'- CCGGCAGTGATTGACAGAATATG -3'
(R):5'- TTGAAGGTCAGATGACACCC -3'
Posted On2014-01-15