Incidental Mutation 'R1211:H2-Bl'
ID100709
Institutional Source Beutler Lab
Gene Symbol H2-Bl
Ensembl Gene ENSMUSG00000073406
Gene Namehistocompatibility 2, blastocyst
Synonymsblastocyst MHC
MMRRC Submission 039280-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.081) question?
Stock #R1211 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location36080115-36084223 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 36081073 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 207 (V207D)
Ref Sequence ENSEMBL: ENSMUSP00000141271 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000173080] [ENSMUST00000183560] [ENSMUST00000183999] [ENSMUST00000184502] [ENSMUST00000185087] [ENSMUST00000185167] [ENSMUST00000192532] [ENSMUST00000194244] [ENSMUST00000195833] [ENSMUST00000195838]
Predicted Effect probably damaging
Transcript: ENSMUST00000173080
AA Change: V310D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000134155
Gene: ENSMUSG00000073406
AA Change: V310D

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:MHC_I 22 200 1.6e-88 PFAM
IGc1 219 289 6.29e-19 SMART
transmembrane domain 305 327 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000174067
AA Change: V218D

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000133982
Gene: ENSMUSG00000073406
AA Change: V218D

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:MHC_I 22 200 6.3e-87 PFAM
transmembrane domain 214 236 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000183560
AA Change: V36D

PolyPhen 2 Score 0.915 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000138812
Gene: ENSMUSG00000073406
AA Change: V36D

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
transmembrane domain 32 54 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000183999
AA Change: V50D

PolyPhen 2 Score 0.915 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000139165
Gene: ENSMUSG00000073406
AA Change: V50D

DomainStartEndE-ValueType
low complexity region 6 14 N/A INTRINSIC
SCOP:d1dr9a2 21 36 4e-5 SMART
transmembrane domain 46 68 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000184502
AA Change: V218D

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000139275
Gene: ENSMUSG00000073406
AA Change: V218D

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:MHC_I 22 200 6.8e-89 PFAM
transmembrane domain 214 236 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184850
Predicted Effect probably benign
Transcript: ENSMUST00000185087
SMART Domains Protein: ENSMUSP00000139166
Gene: ENSMUSG00000073406

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:MHC_I 22 113 5.2e-44 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000185167
SMART Domains Protein: ENSMUSP00000139373
Gene: ENSMUSG00000073406

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000192532
AA Change: V300D

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000142113
Gene: ENSMUSG00000073406
AA Change: V300D

DomainStartEndE-ValueType
Pfam:MHC_I 12 190 1.4e-88 PFAM
IGc1 209 279 6.29e-19 SMART
transmembrane domain 295 317 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000194244
AA Change: V218D

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000141809
Gene: ENSMUSG00000073406
AA Change: V218D

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:MHC_I 22 118 2.9e-43 PFAM
IGc1 127 197 6.29e-19 SMART
transmembrane domain 213 235 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000195833
AA Change: V207D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000141271
Gene: ENSMUSG00000073406
AA Change: V207D

DomainStartEndE-ValueType
Pfam:MHC_I 12 107 1.8e-37 PFAM
IGc1 116 186 6.29e-19 SMART
transmembrane domain 202 224 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000195838
AA Change: V299D

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000141253
Gene: ENSMUSG00000073406
AA Change: V299D

DomainStartEndE-ValueType
Pfam:MHC_I 12 189 1e-82 PFAM
IGc1 208 278 6.29e-19 SMART
transmembrane domain 294 316 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.2%
  • 10x: 95.3%
  • 20x: 89.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 15 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgra3 T C 5: 50,006,876 M254V possibly damaging Het
Arrdc3 A G 13: 80,890,698 T40A possibly damaging Het
Cntnap1 C A 11: 101,184,710 Q905K probably damaging Het
Dclk1 A G 3: 55,380,823 I256V probably benign Het
Dync1h1 G A 12: 110,636,509 E2195K probably benign Het
Erlec1 A G 11: 30,948,298 probably null Het
Gm10160 A T 7: 81,855,749 Y16N probably benign Het
Gm10608 C CNNNNNNNN 9: 119,160,712 probably null Het
Kcna4 AGAGGAGGAGGAGGAGGAGG AGAGGAGGAGGAGGAGG 2: 107,295,315 probably benign Het
Mycbp2 A T 14: 103,120,563 D4488E probably benign Het
Ndufaf1 A G 2: 119,655,675 S319P probably damaging Het
Olfr193 A C 16: 59,110,160 V150G possibly damaging Het
Smad4 T C 18: 73,649,911 probably null Het
Spaca7 T C 8: 12,573,139 S12P probably damaging Het
Stx11 A G 10: 12,941,411 S190P probably damaging Het
Other mutations in H2-Bl
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0396:H2-Bl UTSW 17 36083722 missense possibly damaging 0.47
R0412:H2-Bl UTSW 17 36081521 splice site probably benign
R0924:H2-Bl UTSW 17 36083932 missense probably damaging 1.00
R1170:H2-Bl UTSW 17 36081091 missense possibly damaging 0.66
R1902:H2-Bl UTSW 17 36083953 missense probably damaging 1.00
R1913:H2-Bl UTSW 17 36081016 missense probably damaging 0.99
R1992:H2-Bl UTSW 17 36081046 missense probably damaging 0.98
R5538:H2-Bl UTSW 17 36081286 missense probably benign 0.35
R6021:H2-Bl UTSW 17 36081274 missense probably damaging 1.00
R7091:H2-Bl UTSW 17 36083941 missense possibly damaging 0.94
R7200:H2-Bl UTSW 17 36081046 missense possibly damaging 0.83
R7711:H2-Bl UTSW 17 36083878 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AGTTCCCAGAACTGACAGAGGACC -3'
(R):5'- TCACCCTGACCTGGCAGTTGAATG -3'

Sequencing Primer
(F):5'- CTGACAGAGGACCCAGGTG -3'
(R):5'- ACATGCCATGTGTACCATGAG -3'
Posted On2014-01-15