Incidental Mutation 'R1211:Smad4'
ID100711
Institutional Source Beutler Lab
Gene Symbol Smad4
Ensembl Gene ENSMUSG00000024515
Gene NameSMAD family member 4
SynonymsDpc4, Smad 4, Madh4, DPC4, D18Wsu70e
MMRRC Submission 039280-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1211 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location73639009-73703780 bp(-) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) T to C at 73649911 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000110589 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025393] [ENSMUST00000114939]
Predicted Effect probably null
Transcript: ENSMUST00000025393
SMART Domains Protein: ENSMUSP00000025393
Gene: ENSMUSG00000024515

DomainStartEndE-ValueType
DWA 31 140 5.77e-65 SMART
low complexity region 286 299 N/A INTRINSIC
DWB 320 529 1.41e-123 SMART
Predicted Effect probably null
Transcript: ENSMUST00000114939
SMART Domains Protein: ENSMUSP00000110589
Gene: ENSMUSG00000024515

DomainStartEndE-ValueType
DWA 31 140 5.77e-65 SMART
low complexity region 286 299 N/A INTRINSIC
DWB 320 529 1.41e-123 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142672
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147315
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.2%
  • 10x: 95.3%
  • 20x: 89.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Smad family of signal transduction proteins. Smad proteins are phosphorylated and activated by transmembrane serine-threonine receptor kinases in response to TGF-beta signaling. The product of this gene forms homomeric complexes and heteromeric complexes with other activated Smad proteins, which then accumulate in the nucleus and regulate the transcription of target genes. This protein binds to DNA and recognizes an 8-bp palindromic sequence (GTCTAGAC) called the Smad-binding element (SBE). The Smad proteins are subject to complex regulation by post-translational modifications. Mutations or deletions in this gene have been shown to result in pancreatic cancer, juvenile polyposis syndrome, and hereditary hemorrhagic telangiectasia syndrome. [provided by RefSeq, Oct 2009]
PHENOTYPE: Homozygotes for targeted null mutations exhibit impaired formation of extraembryonic membrane and endoderm and die prior to gastrulation. Heterozygotes develop polyposis of the glandular stomach and duodenum. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 15 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgra3 T C 5: 50,006,876 M254V possibly damaging Het
Arrdc3 A G 13: 80,890,698 T40A possibly damaging Het
Cntnap1 C A 11: 101,184,710 Q905K probably damaging Het
Dclk1 A G 3: 55,380,823 I256V probably benign Het
Dync1h1 G A 12: 110,636,509 E2195K probably benign Het
Erlec1 A G 11: 30,948,298 probably null Het
Gm10160 A T 7: 81,855,749 Y16N probably benign Het
Gm10608 C CNNNNNNNN 9: 119,160,712 probably null Het
H2-Bl A T 17: 36,081,073 V207D probably damaging Het
Kcna4 AGAGGAGGAGGAGGAGGAGG AGAGGAGGAGGAGGAGG 2: 107,295,315 probably benign Het
Mycbp2 A T 14: 103,120,563 D4488E probably benign Het
Ndufaf1 A G 2: 119,655,675 S319P probably damaging Het
Olfr193 A C 16: 59,110,160 V150G possibly damaging Het
Spaca7 T C 8: 12,573,139 S12P probably damaging Het
Stx11 A G 10: 12,941,411 S190P probably damaging Het
Other mutations in Smad4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01012:Smad4 APN 18 73675809 missense probably damaging 1.00
IGL01647:Smad4 APN 18 73640473 splice site probably benign
IGL02055:Smad4 APN 18 73641928 splice site probably benign
IGL02101:Smad4 APN 18 73658652 missense probably benign 0.02
IGL02306:Smad4 APN 18 73662869 critical splice acceptor site probably null
R0391:Smad4 UTSW 18 73658649 missense probably benign
R1118:Smad4 UTSW 18 73640262 missense probably benign 0.41
R1163:Smad4 UTSW 18 73648907 missense probably damaging 0.99
R1616:Smad4 UTSW 18 73640262 missense probably benign 0.41
R1742:Smad4 UTSW 18 73675897 missense probably damaging 1.00
R1829:Smad4 UTSW 18 73641894 missense probably benign 0.20
R2045:Smad4 UTSW 18 73649806 nonsense probably null
R2126:Smad4 UTSW 18 73662744 missense probably benign 0.02
R3013:Smad4 UTSW 18 73648904 missense probably damaging 1.00
R3973:Smad4 UTSW 18 73677736 missense possibly damaging 0.49
R3974:Smad4 UTSW 18 73677736 missense possibly damaging 0.49
R3975:Smad4 UTSW 18 73677736 missense possibly damaging 0.49
R4879:Smad4 UTSW 18 73641903 missense probably damaging 1.00
R5101:Smad4 UTSW 18 73675860 missense probably benign 0.41
R5597:Smad4 UTSW 18 73662827 missense probably benign
R5984:Smad4 UTSW 18 73677911 start codon destroyed probably benign 0.29
R6450:Smad4 UTSW 18 73677746 missense possibly damaging 0.73
R7450:Smad4 UTSW 18 73677853 missense probably damaging 1.00
R7524:Smad4 UTSW 18 73675871 missense probably damaging 1.00
R8001:Smad4 UTSW 18 73641810 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GTGGACATTGGAGAGTTGACCCAAG -3'
(R):5'- AGACCACAGAACAGATGTGCAATCG -3'

Sequencing Primer
(F):5'- GTTGACCCAAGCAAAAGCG -3'
(R):5'- atccacctgtttctgcctc -3'
Posted On2014-01-15