Incidental Mutation 'R1163:Eme2'
ID100714
Institutional Source Beutler Lab
Gene Symbol Eme2
Ensembl Gene ENSMUSG00000073436
Gene Nameessential meiotic structure-specific endonuclease subunit 2
Synonyms
MMRRC Submission 039236-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.069) question?
Stock #R1163 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location24888486-24895087 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 24892918 bp
ZygosityHeterozygous
Amino Acid Change Serine to Phenylalanine at position 263 (S263F)
Ref Sequence ENSEMBL: ENSMUSP00000113936 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024976] [ENSMUST00000024978] [ENSMUST00000043907] [ENSMUST00000068508] [ENSMUST00000088345] [ENSMUST00000115228] [ENSMUST00000115229] [ENSMUST00000117509] [ENSMUST00000117890] [ENSMUST00000119829] [ENSMUST00000119848] [ENSMUST00000120943] [ENSMUST00000121542] [ENSMUST00000121723] [ENSMUST00000121787] [ENSMUST00000130194] [ENSMUST00000139754] [ENSMUST00000144430] [ENSMUST00000146923] [ENSMUST00000154236] [ENSMUST00000168265] [ENSMUST00000178969]
Predicted Effect probably benign
Transcript: ENSMUST00000024976
SMART Domains Protein: ENSMUSP00000024976
Gene: ENSMUSG00000024160

DomainStartEndE-ValueType
low complexity region 34 45 N/A INTRINSIC
low complexity region 52 65 N/A INTRINSIC
low complexity region 73 84 N/A INTRINSIC
low complexity region 133 144 N/A INTRINSIC
Pfam:SPRY 181 304 5.7e-18 PFAM
SOCS_box 309 347 2.8e0 SMART
low complexity region 364 373 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000024978
SMART Domains Protein: ENSMUSP00000024978
Gene: ENSMUSG00000073435

DomainStartEndE-ValueType
NDK 21 158 1.06e-90 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000043907
SMART Domains Protein: ENSMUSP00000045111
Gene: ENSMUSG00000038880

DomainStartEndE-ValueType
low complexity region 9 25 N/A INTRINSIC
Pfam:MRP-S34 61 187 5.3e-52 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000068508
SMART Domains Protein: ENSMUSP00000068567
Gene: ENSMUSG00000024160

DomainStartEndE-ValueType
low complexity region 17 30 N/A INTRINSIC
low complexity region 38 49 N/A INTRINSIC
low complexity region 98 109 N/A INTRINSIC
Pfam:SPRY 146 252 1.3e-13 PFAM
low complexity region 295 308 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000088345
SMART Domains Protein: ENSMUSP00000085683
Gene: ENSMUSG00000024163

DomainStartEndE-ValueType
Pfam:Jnk-SapK_ap_N 29 186 1.4e-72 PFAM
low complexity region 236 249 N/A INTRINSIC
low complexity region 261 270 N/A INTRINSIC
PDB:2W83|D 417 472 6e-20 PDB
coiled coil region 525 555 N/A INTRINSIC
low complexity region 582 596 N/A INTRINSIC
low complexity region 754 769 N/A INTRINSIC
low complexity region 893 901 N/A INTRINSIC
low complexity region 928 940 N/A INTRINSIC
SCOP:d1flga_ 987 1167 4e-8 SMART
Blast:WD40 1075 1116 6e-18 BLAST
low complexity region 1260 1276 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115228
SMART Domains Protein: ENSMUSP00000110883
Gene: ENSMUSG00000024163

DomainStartEndE-ValueType
Pfam:Jnk-SapK_ap_N 29 186 1.4e-72 PFAM
low complexity region 236 249 N/A INTRINSIC
low complexity region 261 270 N/A INTRINSIC
PDB:2W83|D 411 466 7e-20 PDB
low complexity region 567 581 N/A INTRINSIC
low complexity region 739 754 N/A INTRINSIC
low complexity region 878 886 N/A INTRINSIC
low complexity region 913 925 N/A INTRINSIC
SCOP:d1flga_ 972 1152 3e-8 SMART
Blast:WD40 1060 1101 6e-18 BLAST
low complexity region 1245 1261 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115229
SMART Domains Protein: ENSMUSP00000110884
Gene: ENSMUSG00000024163

DomainStartEndE-ValueType
Pfam:Jnk-SapK_ap_N 29 184 2.9e-60 PFAM
low complexity region 244 257 N/A INTRINSIC
low complexity region 269 278 N/A INTRINSIC
Pfam:JIP_LZII 423 493 3.1e-32 PFAM
coiled coil region 533 563 N/A INTRINSIC
low complexity region 590 604 N/A INTRINSIC
low complexity region 762 777 N/A INTRINSIC
low complexity region 901 909 N/A INTRINSIC
low complexity region 936 948 N/A INTRINSIC
SCOP:d1flga_ 995 1175 4e-8 SMART
Blast:WD40 1083 1124 7e-18 BLAST
low complexity region 1268 1284 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000117509
SMART Domains Protein: ENSMUSP00000112712
Gene: ENSMUSG00000024163

DomainStartEndE-ValueType
Pfam:Jnk-SapK_ap_N 29 186 1.4e-72 PFAM
low complexity region 238 247 N/A INTRINSIC
PDB:2W83|D 394 449 7e-20 PDB
coiled coil region 502 532 N/A INTRINSIC
low complexity region 559 573 N/A INTRINSIC
low complexity region 731 746 N/A INTRINSIC
low complexity region 870 878 N/A INTRINSIC
low complexity region 905 917 N/A INTRINSIC
SCOP:d1flga_ 964 1144 3e-8 SMART
Blast:WD40 1052 1093 6e-18 BLAST
low complexity region 1237 1253 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000117890
SMART Domains Protein: ENSMUSP00000112380
Gene: ENSMUSG00000024160

DomainStartEndE-ValueType
low complexity region 17 30 N/A INTRINSIC
low complexity region 38 49 N/A INTRINSIC
low complexity region 98 109 N/A INTRINSIC
Pfam:SPRY 146 269 1.6e-18 PFAM
SOCS_box 274 312 2.8e0 SMART
low complexity region 329 338 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000119829
SMART Domains Protein: ENSMUSP00000112589
Gene: ENSMUSG00000024160

DomainStartEndE-ValueType
low complexity region 17 30 N/A INTRINSIC
low complexity region 38 49 N/A INTRINSIC
low complexity region 98 109 N/A INTRINSIC
Pfam:SPRY 146 294 6.9e-16 PFAM
SOCS_box 299 337 2.8e0 SMART
low complexity region 354 363 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000119848
AA Change: S263F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000113167
Gene: ENSMUSG00000073436
AA Change: S263F

DomainStartEndE-ValueType
low complexity region 13 24 N/A INTRINSIC
ERCC4 71 320 8.51e-23 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000120943
SMART Domains Protein: ENSMUSP00000112492
Gene: ENSMUSG00000024160

DomainStartEndE-ValueType
low complexity region 17 30 N/A INTRINSIC
low complexity region 38 49 N/A INTRINSIC
low complexity region 98 109 N/A INTRINSIC
Pfam:SPRY 146 269 1.6e-18 PFAM
SOCS_box 274 312 2.8e0 SMART
low complexity region 329 338 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000121542
AA Change: S263F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113936
Gene: ENSMUSG00000073436
AA Change: S263F

DomainStartEndE-ValueType
low complexity region 13 24 N/A INTRINSIC
ERCC4 71 320 1.4e-23 SMART
low complexity region 366 373 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000121723
SMART Domains Protein: ENSMUSP00000113698
Gene: ENSMUSG00000024163

DomainStartEndE-ValueType
Pfam:Jnk-SapK_ap_N 29 186 1e-72 PFAM
low complexity region 230 239 N/A INTRINSIC
PDB:2W83|D 386 441 7e-20 PDB
coiled coil region 494 524 N/A INTRINSIC
low complexity region 551 565 N/A INTRINSIC
low complexity region 723 738 N/A INTRINSIC
low complexity region 862 870 N/A INTRINSIC
low complexity region 897 909 N/A INTRINSIC
SCOP:d1flga_ 956 1136 3e-8 SMART
Blast:WD40 1044 1085 5e-18 BLAST
low complexity region 1229 1245 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000121787
SMART Domains Protein: ENSMUSP00000113753
Gene: ENSMUSG00000024163

DomainStartEndE-ValueType
Pfam:Jnk-SapK_ap_N 29 186 3.8e-73 PFAM
low complexity region 230 239 N/A INTRINSIC
PDB:2W83|D 380 435 8e-20 PDB
coiled coil region 488 518 N/A INTRINSIC
low complexity region 545 559 N/A INTRINSIC
low complexity region 717 732 N/A INTRINSIC
low complexity region 856 864 N/A INTRINSIC
low complexity region 891 903 N/A INTRINSIC
SCOP:d1flga_ 950 1130 3e-8 SMART
Blast:WD40 1038 1079 6e-18 BLAST
low complexity region 1223 1239 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125532
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127293
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128953
Predicted Effect probably benign
Transcript: ENSMUST00000130194
SMART Domains Protein: ENSMUSP00000119896
Gene: ENSMUSG00000024160

DomainStartEndE-ValueType
low complexity region 17 30 N/A INTRINSIC
low complexity region 38 49 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134932
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138648
Predicted Effect probably benign
Transcript: ENSMUST00000139754
SMART Domains Protein: ENSMUSP00000118245
Gene: ENSMUSG00000073436

DomainStartEndE-ValueType
low complexity region 13 24 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140688
Predicted Effect probably benign
Transcript: ENSMUST00000144430
SMART Domains Protein: ENSMUSP00000117226
Gene: ENSMUSG00000024160

DomainStartEndE-ValueType
low complexity region 43 58 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145688
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145882
Predicted Effect probably benign
Transcript: ENSMUST00000146923
SMART Domains Protein: ENSMUSP00000114802
Gene: ENSMUSG00000024163

DomainStartEndE-ValueType
Pfam:Jnk-SapK_ap_N 29 186 1.4e-72 PFAM
low complexity region 236 249 N/A INTRINSIC
low complexity region 261 270 N/A INTRINSIC
PDB:2W83|D 417 472 6e-20 PDB
coiled coil region 525 555 N/A INTRINSIC
low complexity region 582 596 N/A INTRINSIC
low complexity region 754 769 N/A INTRINSIC
low complexity region 893 901 N/A INTRINSIC
low complexity region 928 940 N/A INTRINSIC
SCOP:d1flga_ 987 1167 4e-8 SMART
Blast:WD40 1075 1116 6e-18 BLAST
low complexity region 1260 1276 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150500
Predicted Effect probably benign
Transcript: ENSMUST00000154236
SMART Domains Protein: ENSMUSP00000120985
Gene: ENSMUSG00000038880

DomainStartEndE-ValueType
low complexity region 9 25 N/A INTRINSIC
low complexity region 59 79 N/A INTRINSIC
Blast:NDK 172 208 3e-12 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154321
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156659
Predicted Effect probably benign
Transcript: ENSMUST00000168265
SMART Domains Protein: ENSMUSP00000126878
Gene: ENSMUSG00000024160

DomainStartEndE-ValueType
low complexity region 29 42 N/A INTRINSIC
low complexity region 55 69 N/A INTRINSIC
low complexity region 145 156 N/A INTRINSIC
low complexity region 163 176 N/A INTRINSIC
low complexity region 184 195 N/A INTRINSIC
low complexity region 244 255 N/A INTRINSIC
Pfam:SPRY 294 416 5.8e-20 PFAM
SOCS_box 420 458 2.8e0 SMART
low complexity region 475 484 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000178969
SMART Domains Protein: ENSMUSP00000136924
Gene: ENSMUSG00000024163

DomainStartEndE-ValueType
Pfam:Jnk-SapK_ap_N 29 186 1.1e-72 PFAM
low complexity region 236 249 N/A INTRINSIC
low complexity region 261 270 N/A INTRINSIC
PDB:2W83|D 417 472 6e-20 PDB
coiled coil region 525 555 N/A INTRINSIC
low complexity region 582 596 N/A INTRINSIC
low complexity region 754 769 N/A INTRINSIC
low complexity region 893 901 N/A INTRINSIC
low complexity region 928 940 N/A INTRINSIC
SCOP:d1flga_ 987 1167 3e-8 SMART
Blast:WD40 1075 1116 6e-18 BLAST
low complexity region 1260 1276 N/A INTRINSIC
Meta Mutation Damage Score 0.3316 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] EME2 forms a heterodimer with MUS81 (MIM 606591) that functions as an XPF (MIM 278760)-type flap/fork endonuclease in DNA repair (Ciccia et al., 2007 [PubMed 17289582]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700113H08Rik T A 10: 87,121,422 Y7N probably damaging Het
4930579F01Rik T G 3: 138,176,510 D18A probably damaging Het
Abca8a T C 11: 110,071,530 D499G probably benign Het
Adamts1 G C 16: 85,802,637 A25G probably benign Het
Adamts2 A T 11: 50,779,714 I552F probably damaging Het
Akap3 A G 6: 126,864,787 D123G probably damaging Het
Ankar C T 1: 72,688,705 V350I possibly damaging Het
Apob A G 12: 8,011,654 T3379A probably damaging Het
Ash1l G T 3: 89,035,263 probably null Het
Atp2b1 T C 10: 98,979,851 I119T possibly damaging Het
B3gnt2 A T 11: 22,836,558 M210K probably benign Het
Bcl11a A G 11: 24,165,143 N829D probably benign Het
Btnl4 T C 17: 34,470,075 E337G possibly damaging Het
Casr A T 16: 36,494,807 V967D probably damaging Het
Cd200 A T 16: 45,392,352 V244D probably damaging Het
Cd200r4 A G 16: 44,838,020 N256D probably benign Het
Cep68 A G 11: 20,240,539 S158P probably damaging Het
Chst10 A T 1: 38,871,702 V123D probably damaging Het
Cobll1 T C 2: 65,098,279 H938R probably damaging Het
Creld2 G A 15: 88,820,631 W103* probably null Het
Dmkn T G 7: 30,765,051 C205G probably damaging Het
Dock8 A G 19: 25,051,503 I24V probably benign Het
Dpp3 C T 19: 4,914,923 W488* probably null Het
Dpp9 C A 17: 56,199,426 A365S possibly damaging Het
Egfr A T 11: 16,883,546 T605S probably benign Het
Fam83g T C 11: 61,703,436 S599P probably damaging Het
Fscn1 G T 5: 142,960,843 W132L probably damaging Het
Gbp2b A G 3: 142,599,096 T98A probably damaging Het
Gm13088 A G 4: 143,656,634 L5P probably damaging Het
Gm4922 C T 10: 18,783,721 A418T possibly damaging Het
Golgb1 G T 16: 36,916,126 V1912L possibly damaging Het
Gon4l T C 3: 88,892,535 L829P probably damaging Het
Grm3 T A 5: 9,570,738 I169L probably benign Het
Gsdma2 A G 11: 98,650,858 D137G probably damaging Het
Hhip T C 8: 79,992,476 Y474C probably damaging Het
Hsph1 A T 5: 149,630,801 V163E probably damaging Het
Ifi203 T C 1: 173,924,137 K373E probably damaging Het
Itsn2 A G 12: 4,712,009 T1540A probably benign Het
Kdm1b T C 13: 47,071,922 V527A probably benign Het
Kdm5d G A Y: 898,029 A22T probably benign Het
Khdrbs1 A T 4: 129,725,586 F254Y possibly damaging Het
Kif26a T C 12: 112,179,945 F1822L probably benign Het
Krt1 C A 15: 101,848,165 E308* probably null Het
Lrrc47 T A 4: 154,011,817 M1K probably null Het
Mrgpra4 A T 7: 47,981,476 W126R probably damaging Het
Nlrp4e G A 7: 23,320,972 V295I probably benign Het
Olfr1100 A G 2: 86,978,676 L40P probably damaging Het
Olfr1258 G T 2: 89,930,105 V99F possibly damaging Het
Olfr1446 T A 19: 12,890,149 T143S probably benign Het
Olfr201 A G 16: 59,269,155 S171P probably benign Het
Olfr206 A T 16: 59,345,062 I213N probably damaging Het
Olfr228 A T 2: 86,483,238 F168Y probably damaging Het
Olfr364-ps1 A T 2: 37,147,027 T272S probably damaging Het
Olfr453 G A 6: 42,744,123 V29I probably benign Het
Olfr798 A G 10: 129,625,647 V138A possibly damaging Het
Plec G T 15: 76,183,838 N1190K possibly damaging Het
Plin1 T C 7: 79,729,971 T44A probably damaging Het
Pou3f2 TTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG TTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG 4: 22,487,697 probably benign Het
Psg27 A G 7: 18,565,309 L29P probably damaging Het
Psmd13 C A 7: 140,897,454 T292N probably damaging Het
Rab1b A T 19: 5,104,656 Y88* probably null Het
Reln T A 5: 21,899,029 I3315L probably benign Het
Rmdn2 A T 17: 79,659,451 M257L probably benign Het
Rnd1 A T 15: 98,676,554 F47L probably damaging Het
Rnf41 G A 10: 128,438,207 V243I probably benign Het
Rnf43 C G 11: 87,729,513 S226R probably damaging Het
Scn5a A T 9: 119,533,927 D542E probably damaging Het
Sema5b A T 16: 35,628,096 I81F probably benign Het
Serinc5 G A 13: 92,682,777 C73Y probably damaging Het
Serpina3g A T 12: 104,239,292 N97Y possibly damaging Het
Shq1 A G 6: 100,637,072 S262P probably damaging Het
Smad4 A T 18: 73,648,907 I428N probably damaging Het
Snip1 G T 4: 125,072,820 G348W probably damaging Het
Spg11 A G 2: 122,070,941 L1506P probably damaging Het
Stard9 G A 2: 120,696,213 V984I possibly damaging Het
Svopl A T 6: 38,029,700 F121I possibly damaging Het
Tjp1 A T 7: 65,323,054 V546E probably damaging Het
Tmem116 T A 5: 121,493,756 F110L probably damaging Het
Ttyh2 C T 11: 114,710,888 T446M probably benign Het
Tubb1 A T 2: 174,457,739 I405L probably benign Het
Uba5 A T 9: 104,055,826 F155L possibly damaging Het
Ubd C T 17: 37,195,321 H33Y probably damaging Het
Ube2cbp A T 9: 86,440,595 D175E probably benign Het
Usp24 A G 4: 106,420,960 Q2293R probably benign Het
Vmn1r175 T A 7: 23,808,512 H230L probably benign Het
Vmn1r88 A G 7: 13,178,133 I139V probably benign Het
Vmn2r1 T C 3: 64,086,625 F131L probably benign Het
Yipf3 T C 17: 46,251,229 probably null Het
Zdhhc19 A G 16: 32,506,440 K192R probably benign Het
Zfy1 G A Y: 725,611 T718I probably damaging Het
Other mutations in Eme2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01122:Eme2 APN 17 24893346 missense possibly damaging 0.53
R0930:Eme2 UTSW 17 24892918 missense probably damaging 1.00
R1302:Eme2 UTSW 17 24892918 missense probably damaging 1.00
R1386:Eme2 UTSW 17 24892918 missense probably damaging 1.00
R1398:Eme2 UTSW 17 24892918 missense probably damaging 1.00
R1522:Eme2 UTSW 17 24892918 missense probably damaging 1.00
R1762:Eme2 UTSW 17 24893393 missense probably benign 0.00
R2327:Eme2 UTSW 17 24894183 missense probably damaging 1.00
R4410:Eme2 UTSW 17 24893624 missense probably benign 0.05
R4635:Eme2 UTSW 17 24894908 missense probably benign 0.12
R7285:Eme2 UTSW 17 24894569 critical splice donor site probably null
R7315:Eme2 UTSW 17 24894866 missense probably damaging 1.00
R7316:Eme2 UTSW 17 24894866 missense probably damaging 1.00
Z1088:Eme2 UTSW 17 24894567 splice site probably null
Predicted Primers
Posted On2014-01-15