Mutagenetix > Incidental Mutations

Incidental Mutation 'R1191:Ubr3'

100771

Institutional Source

Beutler Lab

Gene Symbol

Ubr3

Ensembl Gene

ENSMUSG00000044308

Gene Name

ubiquitin protein ligase E3 component n-recognin 3

Synonyms

Zfp650, 4833421P10Rik, A130030D10Rik, 1110059H15Rik

MMRRC Submission

039263-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R1191 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

69897246-70024013 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

C to T at 70021181 bp

Zygosity

Heterozygous

Amino Acid Change

Arginine to Stop codon at position 1831 (R1831*)

Ref Sequence

ENSEMBL: ENSMUSP00000107870 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000055758] [ENSMUST00000112251]

Predicted Effect

probably null
Transcript: ENSMUST00000055758
AA Change: R1828*

SMART Domains

Protein: ENSMUSP00000060159
Gene: ENSMUSG00000044308
AA Change: R1828*

Domain	Start	End	E-Value	Type
low complexity region	13	40	N/A	INTRINSIC
low complexity region	67	88	N/A	INTRINSIC
Pfam:zf-UBR	118	188	1.6e-19	PFAM
low complexity region	339	354	N/A	INTRINSIC
low complexity region	570	580	N/A	INTRINSIC
low complexity region	1016	1027	N/A	INTRINSIC
low complexity region	1082	1101	N/A	INTRINSIC
coiled coil region	1167	1199	N/A	INTRINSIC
Blast:RING	1289	1363	8e-39	BLAST

Predicted Effect

probably null
Transcript: ENSMUST00000112251
AA Change: R1831*

SMART Domains

Protein: ENSMUSP00000107870
Gene: ENSMUSG00000044308
AA Change: R1831*

Domain	Start	End	E-Value	Type
low complexity region	13	40	N/A	INTRINSIC
low complexity region	67	88	N/A	INTRINSIC
Pfam:zf-UBR	119	187	1.7e-21	PFAM
low complexity region	338	353	N/A	INTRINSIC
low complexity region	569	579	N/A	INTRINSIC
low complexity region	1015	1026	N/A	INTRINSIC
low complexity region	1081	1100	N/A	INTRINSIC
coiled coil region	1166	1198	N/A	INTRINSIC
Blast:RING	1288	1362	8e-39	BLAST

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000123890

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000126165

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000136543

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000150301

Coding Region Coverage

1x: 99.4%
3x: 98.3%
10x: 95.1%
20x: 87.9%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Homozygous null mice obtained on a coisogenic 129S1 background die early in embryogenesis while those on a mixed 129S1/B6 background are born at a slightly reduced frequency. On a congenic C57BL/6 background, homozygotes display neonatal lethality, impaired suckling and female behavioral anosmia. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 38 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ankrd27	T	C	7: 35,602,487	F144L	probably damaging	Het
C8b	C	T	4: 104,793,323	P377S	probably damaging	Het
Cfi	C	A	3: 129,868,527	T385N	probably benign	Het
Col15a1	G	T	4: 47,254,083	G300*	probably null	Het
Crlf1	G	A	8: 70,498,828	C119Y	probably damaging	Het
Dcaf4	A	T	12: 83,535,967	S279C	probably damaging	Het
Gde1	A	T	7: 118,705,441	H70Q	probably damaging	Het
Gpt2	A	T	8: 85,509,272	N179I	probably damaging	Het
Grik5	G	A	7: 25,058,325	Q410*	probably null	Het
Hspa2	C	T	12: 76,405,881	R450W	probably damaging	Het
Idh3b	A	T	2: 130,281,890	M118K	probably benign	Het
Ighv5-21	T	C	12: 114,322,803		probably benign	Het
Il12rb2	C	T	6: 67,298,216	V642M	possibly damaging	Het
Iqcg	A	G	16: 33,049,943	V60A	probably benign	Het
Irx6	T	A	8: 92,676,952	Y102N	probably damaging	Het
Itgb6	C	T	2: 60,653,137		probably null	Het
Mmp27	A	T	9: 7,579,066		probably null	Het
Olfr143	G	T	9: 38,254,205	V263F	probably damaging	Het
Olfr175-ps1	T	A	16: 58,824,559	Y50F	probably benign	Het
Olfr452	C	A	6: 42,790,517	H159Q	probably benign	Het
Olfr50	T	A	2: 36,793,338	M34K	probably damaging	Het
Olfr976	A	T	9: 39,956,968	M1K	probably null	Het
Pcdhb16	A	G	18: 37,479,873	R629G	probably damaging	Het
Pde3b	A	T	7: 114,519,575	M650L	probably benign	Het
Rfwd3	C	T	8: 111,288,242	R326Q	probably damaging	Het
Skint3	T	A	4: 112,235,742	M1K	probably null	Het
Strn	T	C	17: 78,692,426	Q127R	possibly damaging	Het
Taar2	T	G	10: 23,941,029	W156G	probably damaging	Het
Trpt1	G	T	19: 6,996,770	M45I	probably benign	Het
Ubap2l	T	C	3: 90,023,575	T357A	probably damaging	Het
Unc79	T	A	12: 103,047,012	Y287*	probably null	Het
Utrn	T	A	10: 12,634,033	K2398N	probably benign	Het
Vav2	A	T	2: 27,292,780		probably null	Het
Vps9d1	A	T	8: 123,247,967	H249Q	possibly damaging	Het
Vwf	T	A	6: 125,599,252	C432S	probably damaging	Het
Zfp369	T	A	13: 65,291,962	Y153*	probably null	Het
Zfp760	C	T	17: 21,723,305	P487L	probably damaging	Het
Zswim2	A	C	2: 83,923,695	V207G	possibly damaging	Het

Other mutations in Ubr3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00088:Ubr3	APN	2	69988810	missense	probably benign	0.40
IGL00985:Ubr3	APN	2	70003431	missense	probably damaging	1.00
IGL01061:Ubr3	APN	2	69983225	missense	probably benign	0.05
IGL01325:Ubr3	APN	2	69917097	missense	possibly damaging	0.71
IGL01398:Ubr3	APN	2	69959653	missense	probably damaging	1.00
IGL01484:Ubr3	APN	2	70021544	nonsense	probably null
IGL01599:Ubr3	APN	2	69938178	missense	probably damaging	1.00
IGL01616:Ubr3	APN	2	70020484	missense	probably benign	0.14
IGL01634:Ubr3	APN	2	69973572	missense	probably benign
IGL01684:Ubr3	APN	2	70016158	nonsense	probably null
IGL01810:Ubr3	APN	2	70003465	splice site	probably null
IGL01813:Ubr3	APN	2	69951570	missense	probably benign	0.34
IGL01994:Ubr3	APN	2	70021176	missense	probably damaging	1.00
IGL02188:Ubr3	APN	2	69959611	nonsense	probably null
IGL02318:Ubr3	APN	2	69979397	missense	probably damaging	1.00
IGL02379:Ubr3	APN	2	69948488	missense	possibly damaging	0.91
IGL02635:Ubr3	APN	2	70020483	missense	probably damaging	0.96
IGL02858:Ubr3	APN	2	69952859	missense	probably damaging	1.00
IGL03140:Ubr3	APN	2	69970189	missense	probably damaging	1.00
IGL03343:Ubr3	APN	2	69973146	splice site	probably benign
Hyrax	UTSW	2	69952868	missense	probably benign	0.32
manatee	UTSW	2	69979386	nonsense	probably null
sea_cow	UTSW	2	69959669	splice site	probably null
R0094:Ubr3	UTSW	2	69951362	missense	probably damaging	1.00
R0094:Ubr3	UTSW	2	69951362	missense	probably damaging	1.00
R0122:Ubr3	UTSW	2	69979412	missense	probably damaging	1.00
R0243:Ubr3	UTSW	2	69951405	missense	probably damaging	1.00
R0710:Ubr3	UTSW	2	69952837	missense	probably damaging	1.00
R0787:Ubr3	UTSW	2	69951421	splice site	probably benign
R1137:Ubr3	UTSW	2	69938315	splice site	probably benign
R1416:Ubr3	UTSW	2	69945071	missense	probably damaging	1.00
R1623:Ubr3	UTSW	2	69977723	nonsense	probably null
R1735:Ubr3	UTSW	2	70009129	missense	probably damaging	1.00
R1789:Ubr3	UTSW	2	70016367	missense	possibly damaging	0.87
R1793:Ubr3	UTSW	2	70000551	splice site	probably benign
R1932:Ubr3	UTSW	2	69953476	splice site	probably null
R2042:Ubr3	UTSW	2	69977774	nonsense	probably null
R2085:Ubr3	UTSW	2	69953764	missense	probably damaging	1.00
R2090:Ubr3	UTSW	2	69936017	missense	probably damaging	1.00
R2112:Ubr3	UTSW	2	69977792	missense	possibly damaging	0.73
R2173:Ubr3	UTSW	2	69897399	missense	probably benign
R2215:Ubr3	UTSW	2	69979317	critical splice acceptor site	probably null
R2273:Ubr3	UTSW	2	70016341	missense	probably benign	0.11
R2274:Ubr3	UTSW	2	70016341	missense	probably benign	0.11
R2275:Ubr3	UTSW	2	70016341	missense	probably benign	0.11
R2292:Ubr3	UTSW	2	69897260	unclassified	probably benign
R2447:Ubr3	UTSW	2	70003380	missense	probably damaging	1.00
R2504:Ubr3	UTSW	2	69938198	missense	probably damaging	0.99
R2517:Ubr3	UTSW	2	69936018	missense	probably damaging	1.00
R2901:Ubr3	UTSW	2	70016192	missense	possibly damaging	0.89
R3109:Ubr3	UTSW	2	69988840	missense	probably damaging	1.00
R3737:Ubr3	UTSW	2	69971234	critical splice donor site	probably null
R3793:Ubr3	UTSW	2	69917181	missense	possibly damaging	0.95
R3821:Ubr3	UTSW	2	69993813	critical splice donor site	probably null
R3918:Ubr3	UTSW	2	70016130	critical splice acceptor site	probably null
R4157:Ubr3	UTSW	2	69959669	splice site	probably null
R4235:Ubr3	UTSW	2	70016385	nonsense	probably null
R4276:Ubr3	UTSW	2	69938387	nonsense	probably null
R4544:Ubr3	UTSW	2	69956093	missense	probably benign	0.18
R4678:Ubr3	UTSW	2	69935919	missense	probably damaging	1.00
R4707:Ubr3	UTSW	2	69938370	intron	probably benign
R4785:Ubr3	UTSW	2	69959603	missense	probably damaging	1.00
R4872:Ubr3	UTSW	2	69970183	missense	probably damaging	1.00
R4887:Ubr3	UTSW	2	70013131	missense	probably damaging	0.99
R4920:Ubr3	UTSW	2	69952868	missense	probably benign	0.32
R4989:Ubr3	UTSW	2	70020446	splice site	probably benign
R5104:Ubr3	UTSW	2	69938256	missense	probably damaging	0.98
R5134:Ubr3	UTSW	2	70020446	splice site	probably benign
R5137:Ubr3	UTSW	2	69973335	missense	probably damaging	1.00
R5174:Ubr3	UTSW	2	70009162	missense	probably damaging	1.00
R5195:Ubr3	UTSW	2	69956034	missense	probably benign	0.00
R5437:Ubr3	UTSW	2	69944390	missense	probably damaging	1.00
R5539:Ubr3	UTSW	2	70020533	missense	probably damaging	1.00
R5781:Ubr3	UTSW	2	70016244	splice site	probably null
R5809:Ubr3	UTSW	2	69965511	missense	possibly damaging	0.90
R5913:Ubr3	UTSW	2	70021215	missense	probably damaging	1.00
R5969:Ubr3	UTSW	2	69979386	nonsense	probably null
R6136:Ubr3	UTSW	2	69993763	missense	probably benign	0.26
R6140:Ubr3	UTSW	2	69973329	missense	probably benign	0.09
R6185:Ubr3	UTSW	2	69938277	missense	probably damaging	0.98
R6220:Ubr3	UTSW	2	70020475	missense	probably damaging	1.00
R6258:Ubr3	UTSW	2	69982864	intron	probably null
R6319:Ubr3	UTSW	2	69973414	missense	probably benign	0.00
R6322:Ubr3	UTSW	2	69956085	nonsense	probably null
R6470:Ubr3	UTSW	2	69965460	missense	probably benign	0.02
R6477:Ubr3	UTSW	2	69979429	nonsense	probably null
R6702:Ubr3	UTSW	2	69956049	missense	probably benign	0.23
R6709:Ubr3	UTSW	2	70013092	missense	probably damaging	1.00
R6803:Ubr3	UTSW	2	69936024	critical splice donor site	probably null
R6806:Ubr3	UTSW	2	69955964	splice site	probably benign
R6834:Ubr3	UTSW	2	70000481	missense	possibly damaging	0.63
R6841:Ubr3	UTSW	2	70020625	missense	probably damaging	1.00
R6847:Ubr3	UTSW	2	69983128	missense	probably damaging	1.00
R6889:Ubr3	UTSW	2	69944300	missense	possibly damaging	0.70
R7065:Ubr3	UTSW	2	69953705	missense	probably damaging	1.00
R7102:Ubr3	UTSW	2	69897822	missense	probably damaging	1.00
R7156:Ubr3	UTSW	2	70021623	missense	probably damaging	1.00
R7209:Ubr3	UTSW	2	70016134	missense	probably benign	0.01
R7273:Ubr3	UTSW	2	69979333	missense	probably damaging	0.97
R7314:Ubr3	UTSW	2	69991600	missense	probably damaging	1.00
R7422:Ubr3	UTSW	2	69953542	critical splice donor site	probably null
R7584:Ubr3	UTSW	2	69991503	missense	probably damaging	1.00
R7588:Ubr3	UTSW	2	69971169	missense	probably damaging	1.00
R7597:Ubr3	UTSW	2	69973468	missense	possibly damaging	0.69
R7697:Ubr3	UTSW	2	69897686	missense	probably damaging	1.00
R7737:Ubr3	UTSW	2	69991566	missense	probably benign	0.07
R7743:Ubr3	UTSW	2	69944449	missense	probably benign	0.28
Z1088:Ubr3	UTSW	2	69922367	missense	probably benign	0.00
Z1177:Ubr3	UTSW	2	69897461	missense	not run
Z1177:Ubr3	UTSW	2	69897666	missense	not run
Z1177:Ubr3	UTSW	2	69973206	missense	not run

Predicted Primers

PCR Primer
(F):5'- CTTTAACATGCAGGGCAGCAGC -3'
(R):5'- AGGTGTGGCACACTGGTTTCTC -3'

Sequencing Primer
(F):5'- AGCCTTCACTGATGCACTGG -3'
(R):5'- TCCTCTCCTGCTGGAGC -3'

Posted On

2014-01-15