Incidental Mutation 'R1191:Skint3'
ID100787
Institutional Source Beutler Lab
Gene Symbol Skint3
Ensembl Gene ENSMUSG00000070868
Gene Nameselection and upkeep of intraepithelial T cells 3
Synonyms
MMRRC Submission 039263-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.070) question?
Stock #R1191 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location112232245-112300468 bp(+) (GRCm38)
Type of Mutationstart codon destroyed
DNA Base Change (assembly) T to A at 112235742 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 1 (M1K)
Ref Sequence ENSEMBL: ENSMUSP00000131300 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038455] [ENSMUST00000170945]
Predicted Effect probably null
Transcript: ENSMUST00000038455
AA Change: M1K

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000042662
Gene: ENSMUSG00000070868
AA Change: M1K

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IG 34 141 3.51e-8 SMART
transmembrane domain 248 270 N/A INTRINSIC
transmembrane domain 291 313 N/A INTRINSIC
transmembrane domain 328 350 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000170945
AA Change: M1K

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000131300
Gene: ENSMUSG00000070868
AA Change: M1K

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IG 34 141 3.51e-8 SMART
transmembrane domain 243 265 N/A INTRINSIC
transmembrane domain 285 304 N/A INTRINSIC
transmembrane domain 319 341 N/A INTRINSIC
transmembrane domain 362 384 N/A INTRINSIC
transmembrane domain 404 426 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.3%
  • 10x: 95.1%
  • 20x: 87.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd27 T C 7: 35,602,487 F144L probably damaging Het
C8b C T 4: 104,793,323 P377S probably damaging Het
Cfi C A 3: 129,868,527 T385N probably benign Het
Col15a1 G T 4: 47,254,083 G300* probably null Het
Crlf1 G A 8: 70,498,828 C119Y probably damaging Het
Dcaf4 A T 12: 83,535,967 S279C probably damaging Het
Gde1 A T 7: 118,705,441 H70Q probably damaging Het
Gpt2 A T 8: 85,509,272 N179I probably damaging Het
Grik5 G A 7: 25,058,325 Q410* probably null Het
Hspa2 C T 12: 76,405,881 R450W probably damaging Het
Idh3b A T 2: 130,281,890 M118K probably benign Het
Ighv5-21 T C 12: 114,322,803 probably benign Het
Il12rb2 C T 6: 67,298,216 V642M possibly damaging Het
Iqcg A G 16: 33,049,943 V60A probably benign Het
Irx6 T A 8: 92,676,952 Y102N probably damaging Het
Itgb6 C T 2: 60,653,137 probably null Het
Mmp27 A T 9: 7,579,066 probably null Het
Olfr143 G T 9: 38,254,205 V263F probably damaging Het
Olfr175-ps1 T A 16: 58,824,559 Y50F probably benign Het
Olfr452 C A 6: 42,790,517 H159Q probably benign Het
Olfr50 T A 2: 36,793,338 M34K probably damaging Het
Olfr976 A T 9: 39,956,968 M1K probably null Het
Pcdhb16 A G 18: 37,479,873 R629G probably damaging Het
Pde3b A T 7: 114,519,575 M650L probably benign Het
Rfwd3 C T 8: 111,288,242 R326Q probably damaging Het
Strn T C 17: 78,692,426 Q127R possibly damaging Het
Taar2 T G 10: 23,941,029 W156G probably damaging Het
Trpt1 G T 19: 6,996,770 M45I probably benign Het
Ubap2l T C 3: 90,023,575 T357A probably damaging Het
Ubr3 C T 2: 70,021,181 R1831* probably null Het
Unc79 T A 12: 103,047,012 Y287* probably null Het
Utrn T A 10: 12,634,033 K2398N probably benign Het
Vav2 A T 2: 27,292,780 probably null Het
Vps9d1 A T 8: 123,247,967 H249Q possibly damaging Het
Vwf T A 6: 125,599,252 C432S probably damaging Het
Zfp369 T A 13: 65,291,962 Y153* probably null Het
Zfp760 C T 17: 21,723,305 P487L probably damaging Het
Zswim2 A C 2: 83,923,695 V207G possibly damaging Het
Other mutations in Skint3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00911:Skint3 APN 4 112255909 splice site probably benign
IGL01344:Skint3 APN 4 112290322 missense possibly damaging 0.53
IGL02875:Skint3 APN 4 112255882 missense possibly damaging 0.88
IGL03308:Skint3 APN 4 112254067 missense probably damaging 1.00
IGL03372:Skint3 APN 4 112255906 splice site probably benign
R0043:Skint3 UTSW 4 112277623 missense probably damaging 0.98
R0671:Skint3 UTSW 4 112255777 nonsense probably null
R0747:Skint3 UTSW 4 112253905 missense probably damaging 1.00
R2058:Skint3 UTSW 4 112255783 nonsense probably null
R3819:Skint3 UTSW 4 112255888 missense possibly damaging 0.68
R3893:Skint3 UTSW 4 112253918 missense probably damaging 0.97
R4166:Skint3 UTSW 4 112255635 missense possibly damaging 0.89
R4449:Skint3 UTSW 4 112270009 missense possibly damaging 0.74
R4662:Skint3 UTSW 4 112277666 nonsense probably null
R4790:Skint3 UTSW 4 112255898 missense possibly damaging 0.49
R5374:Skint3 UTSW 4 112298189 missense possibly damaging 0.81
R5570:Skint3 UTSW 4 112235798 missense probably benign 0.08
R6024:Skint3 UTSW 4 112290346 missense possibly damaging 0.66
R6306:Skint3 UTSW 4 112255875 missense probably damaging 1.00
R6552:Skint3 UTSW 4 112290285 missense possibly damaging 0.95
R6619:Skint3 UTSW 4 112253864 missense probably damaging 1.00
R6972:Skint3 UTSW 4 112258892 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GGAAGTGCCATAATCGTGTCTGGAAA -3'
(R):5'- TTTGTAGTCTGCAACAATTCCTCAGTGT -3'

Sequencing Primer
(F):5'- ACAAGTGACCTGATAAGGTTTCC -3'
(R):5'- TGAAATATTGAGTCCTCCAGGC -3'
Posted On2014-01-15