Incidental Mutation 'R1191:Olfr976'
ID100817
Institutional Source Beutler Lab
Gene Symbol Olfr976
Ensembl Gene ENSMUSG00000047352
Gene Nameolfactory receptor 976
SynonymsGA_x6K02T2PVTD-33657378-33656440, MOR224-10
MMRRC Submission 039263-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock #R1191 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location39954139-39961133 bp(-) (GRCm38)
Type of Mutationstart codon destroyed
DNA Base Change (assembly) A to T at 39956968 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 1 (M1K)
Ref Sequence ENSEMBL: ENSMUSP00000133083 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000169307] [ENSMUST00000213171] [ENSMUST00000216647] [ENSMUST00000217360] [ENSMUST00000217630]
Predicted Effect probably null
Transcript: ENSMUST00000169307
AA Change: M1K

PolyPhen 2 Score 0.024 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000133083
Gene: ENSMUSG00000047352
AA Change: M1K

DomainStartEndE-ValueType
Pfam:7tm_4 43 318 1.5e-48 PFAM
Pfam:7TM_GPCR_Srsx 47 271 1.1e-5 PFAM
Pfam:7tm_1 53 300 2.8e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213171
Predicted Effect probably benign
Transcript: ENSMUST00000216647
Predicted Effect probably benign
Transcript: ENSMUST00000217360
Predicted Effect probably benign
Transcript: ENSMUST00000217630
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.3%
  • 10x: 95.1%
  • 20x: 87.9%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd27 T C 7: 35,602,487 F144L probably damaging Het
C8b C T 4: 104,793,323 P377S probably damaging Het
Cfi C A 3: 129,868,527 T385N probably benign Het
Col15a1 G T 4: 47,254,083 G300* probably null Het
Crlf1 G A 8: 70,498,828 C119Y probably damaging Het
Dcaf4 A T 12: 83,535,967 S279C probably damaging Het
Gde1 A T 7: 118,705,441 H70Q probably damaging Het
Gpt2 A T 8: 85,509,272 N179I probably damaging Het
Grik5 G A 7: 25,058,325 Q410* probably null Het
Hspa2 C T 12: 76,405,881 R450W probably damaging Het
Idh3b A T 2: 130,281,890 M118K probably benign Het
Ighv5-21 T C 12: 114,322,803 probably benign Het
Il12rb2 C T 6: 67,298,216 V642M possibly damaging Het
Iqcg A G 16: 33,049,943 V60A probably benign Het
Irx6 T A 8: 92,676,952 Y102N probably damaging Het
Itgb6 C T 2: 60,653,137 probably null Het
Mmp27 A T 9: 7,579,066 probably null Het
Olfr143 G T 9: 38,254,205 V263F probably damaging Het
Olfr175-ps1 T A 16: 58,824,559 Y50F probably benign Het
Olfr452 C A 6: 42,790,517 H159Q probably benign Het
Olfr50 T A 2: 36,793,338 M34K probably damaging Het
Pcdhb16 A G 18: 37,479,873 R629G probably damaging Het
Pde3b A T 7: 114,519,575 M650L probably benign Het
Rfwd3 C T 8: 111,288,242 R326Q probably damaging Het
Skint3 T A 4: 112,235,742 M1K probably null Het
Strn T C 17: 78,692,426 Q127R possibly damaging Het
Taar2 T G 10: 23,941,029 W156G probably damaging Het
Trpt1 G T 19: 6,996,770 M45I probably benign Het
Ubap2l T C 3: 90,023,575 T357A probably damaging Het
Ubr3 C T 2: 70,021,181 R1831* probably null Het
Unc79 T A 12: 103,047,012 Y287* probably null Het
Utrn T A 10: 12,634,033 K2398N probably benign Het
Vav2 A T 2: 27,292,780 probably null Het
Vps9d1 A T 8: 123,247,967 H249Q possibly damaging Het
Vwf T A 6: 125,599,252 C432S probably damaging Het
Zfp369 T A 13: 65,291,962 Y153* probably null Het
Zfp760 C T 17: 21,723,305 P487L probably damaging Het
Zswim2 A C 2: 83,923,695 V207G possibly damaging Het
Other mutations in Olfr976
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00960:Olfr976 APN 9 39956159 missense probably damaging 1.00
IGL02455:Olfr976 APN 9 39956902 missense probably damaging 0.96
R1962:Olfr976 UTSW 9 39956683 missense probably benign 0.00
R2328:Olfr976 UTSW 9 39956900 missense possibly damaging 0.95
R3847:Olfr976 UTSW 9 39956581 missense probably damaging 1.00
R4032:Olfr976 UTSW 9 39956333 missense probably benign 0.14
R4620:Olfr976 UTSW 9 39956909 missense probably damaging 1.00
R5152:Olfr976 UTSW 9 39956906 missense probably benign 0.02
R5163:Olfr976 UTSW 9 39956920 missense probably damaging 1.00
R5323:Olfr976 UTSW 9 39956829 nonsense probably null
R5709:Olfr976 UTSW 9 39956563 missense probably damaging 0.98
R7028:Olfr976 UTSW 9 39956345 missense probably benign 0.00
R7085:Olfr976 UTSW 9 39956512 missense probably damaging 1.00
R7723:Olfr976 UTSW 9 39956624 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- GCAGGTTTCCCAACAAGGCAAAG -3'
(R):5'- ACACTCACATATTGAGGCAATCGGC -3'

Sequencing Primer
(F):5'- TTCCCAACAAGGCAAAGACATAAAAG -3'
(R):5'- TGAGGCAATCGGCTTACATAC -3'
Posted On2014-01-15