Incidental Mutation 'R1191:Dcaf4'
ID100831
Institutional Source Beutler Lab
Gene Symbol Dcaf4
Ensembl Gene ENSMUSG00000021222
Gene NameDDB1 and CUL4 associated factor 4
Synonyms1110018E21Rik, Wdr21
MMRRC Submission 039263-MU
Accession Numbers

Genbank: NM_030246; MGI: 1921078

Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock #R1191 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location83520466-83541920 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 83535967 bp
ZygosityHeterozygous
Amino Acid Change Serine to Cysteine at position 279 (S279C)
Ref Sequence ENSEMBL: ENSMUSP00000152717 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021645] [ENSMUST00000223291]
Predicted Effect probably damaging
Transcript: ENSMUST00000021645
AA Change: S266C

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000021645
Gene: ENSMUSG00000021222
AA Change: S266C

DomainStartEndE-ValueType
low complexity region 8 16 N/A INTRINSIC
low complexity region 48 61 N/A INTRINSIC
Blast:WD40 274 313 2e-14 BLAST
WD40 361 399 8.36e-2 SMART
WD40 402 443 7.4e0 SMART
Blast:WD40 446 494 1e-15 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221769
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221944
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222607
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222725
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222833
Predicted Effect probably damaging
Transcript: ENSMUST00000223291
AA Change: S279C

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.3%
  • 10x: 95.1%
  • 20x: 87.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a WD repeat-containing protein that interacts with the Cul4-Ddb1 E3 ligase macromolecular complex. Multiple alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jul 2009]
Allele List at MGI

All alleles(39) : Gene trapped(39)

Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd27 T C 7: 35,602,487 F144L probably damaging Het
C8b C T 4: 104,793,323 P377S probably damaging Het
Cfi C A 3: 129,868,527 T385N probably benign Het
Col15a1 G T 4: 47,254,083 G300* probably null Het
Crlf1 G A 8: 70,498,828 C119Y probably damaging Het
Gde1 A T 7: 118,705,441 H70Q probably damaging Het
Gpt2 A T 8: 85,509,272 N179I probably damaging Het
Grik5 G A 7: 25,058,325 Q410* probably null Het
Hspa2 C T 12: 76,405,881 R450W probably damaging Het
Idh3b A T 2: 130,281,890 M118K probably benign Het
Ighv5-21 T C 12: 114,322,803 probably benign Het
Il12rb2 C T 6: 67,298,216 V642M possibly damaging Het
Iqcg A G 16: 33,049,943 V60A probably benign Het
Irx6 T A 8: 92,676,952 Y102N probably damaging Het
Itgb6 C T 2: 60,653,137 probably null Het
Mmp27 A T 9: 7,579,066 probably null Het
Olfr143 G T 9: 38,254,205 V263F probably damaging Het
Olfr175-ps1 T A 16: 58,824,559 Y50F probably benign Het
Olfr452 C A 6: 42,790,517 H159Q probably benign Het
Olfr50 T A 2: 36,793,338 M34K probably damaging Het
Olfr976 A T 9: 39,956,968 M1K probably null Het
Pcdhb16 A G 18: 37,479,873 R629G probably damaging Het
Pde3b A T 7: 114,519,575 M650L probably benign Het
Rfwd3 C T 8: 111,288,242 R326Q probably damaging Het
Skint3 T A 4: 112,235,742 M1K probably null Het
Strn T C 17: 78,692,426 Q127R possibly damaging Het
Taar2 T G 10: 23,941,029 W156G probably damaging Het
Trpt1 G T 19: 6,996,770 M45I probably benign Het
Ubap2l T C 3: 90,023,575 T357A probably damaging Het
Ubr3 C T 2: 70,021,181 R1831* probably null Het
Unc79 T A 12: 103,047,012 Y287* probably null Het
Utrn T A 10: 12,634,033 K2398N probably benign Het
Vav2 A T 2: 27,292,780 probably null Het
Vps9d1 A T 8: 123,247,967 H249Q possibly damaging Het
Vwf T A 6: 125,599,252 C432S probably damaging Het
Zfp369 T A 13: 65,291,962 Y153* probably null Het
Zfp760 C T 17: 21,723,305 P487L probably damaging Het
Zswim2 A C 2: 83,923,695 V207G possibly damaging Het
Other mutations in Dcaf4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00763:Dcaf4 APN 12 83539333 missense probably damaging 1.00
IGL01401:Dcaf4 APN 12 83541374 missense probably damaging 1.00
IGL02393:Dcaf4 APN 12 83530031 missense probably damaging 1.00
IGL02970:Dcaf4 APN 12 83529215 missense probably damaging 0.99
F5770:Dcaf4 UTSW 12 83537701 splice site probably null
PIT4504001:Dcaf4 UTSW 12 83534011 critical splice donor site probably null
R0032:Dcaf4 UTSW 12 83535988 splice site probably benign
R0032:Dcaf4 UTSW 12 83535988 splice site probably benign
R0164:Dcaf4 UTSW 12 83535988 splice site probably benign
R0165:Dcaf4 UTSW 12 83535988 splice site probably benign
R0167:Dcaf4 UTSW 12 83535988 splice site probably benign
R0211:Dcaf4 UTSW 12 83535961 missense probably damaging 1.00
R0211:Dcaf4 UTSW 12 83535961 missense probably damaging 1.00
R0594:Dcaf4 UTSW 12 83538043 critical splice donor site probably null
R4499:Dcaf4 UTSW 12 83539360 missense probably damaging 1.00
R4896:Dcaf4 UTSW 12 83539459 missense possibly damaging 0.86
R4932:Dcaf4 UTSW 12 83532304 missense possibly damaging 0.61
R5882:Dcaf4 UTSW 12 83539429 missense probably damaging 0.96
R7084:Dcaf4 UTSW 12 83537797 frame shift probably null
R7564:Dcaf4 UTSW 12 83541523 missense probably damaging 0.97
R7777:Dcaf4 UTSW 12 83537959 missense probably damaging 0.97
V7583:Dcaf4 UTSW 12 83537701 splice site probably null
Predicted Primers PCR Primer
(F):5'- TCCTGAAGAGACGGAAACTGAATGC -3'
(R):5'- GCTGACATGACCTCAAAGGGCTTAC -3'

Sequencing Primer
(F):5'- ACATCTGGACAGTGTTCTCTG -3'
(R):5'- TGCAAACTCTAGGATGCAGC -3'
Posted On2014-01-15