Incidental Mutation 'R1191:Zfp369'
ID100835
Institutional Source Beutler Lab
Gene Symbol Zfp369
Ensembl Gene ENSMUSG00000021514
Gene Namezinc finger protein 369
SynonymsB930030B22Rik, NRIF2, D230020H11Rik
MMRRC Submission 039263-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.105) question?
Stock #R1191 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location65278814-65304221 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 65291962 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 153 (Y153*)
Ref Sequence ENSEMBL: ENSMUSP00000116221 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000126879] [ENSMUST00000130799]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125510
Predicted Effect probably null
Transcript: ENSMUST00000126879
AA Change: Y153*
SMART Domains Protein: ENSMUSP00000119114
Gene: ENSMUSG00000021514
AA Change: Y153*

DomainStartEndE-ValueType
KRAB 35 95 7.13e-20 SMART
SCAN 178 289 2.57e-39 SMART
KRAB 300 367 1.63e-14 SMART
low complexity region 440 452 N/A INTRINSIC
ZnF_C2H2 701 723 5.42e-2 SMART
ZnF_C2H2 729 751 4.79e-3 SMART
ZnF_C2H2 757 779 1.47e-3 SMART
ZnF_C2H2 785 807 2.43e-4 SMART
ZnF_C2H2 813 835 6.88e-4 SMART
Predicted Effect probably null
Transcript: ENSMUST00000130799
AA Change: Y153*
SMART Domains Protein: ENSMUSP00000116221
Gene: ENSMUSG00000021514
AA Change: Y153*

DomainStartEndE-ValueType
KRAB 35 95 7.13e-20 SMART
SCAN 178 289 2.57e-39 SMART
KRAB 300 354 3.54e-15 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221365
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.3%
  • 10x: 95.1%
  • 20x: 87.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd27 T C 7: 35,602,487 F144L probably damaging Het
C8b C T 4: 104,793,323 P377S probably damaging Het
Cfi C A 3: 129,868,527 T385N probably benign Het
Col15a1 G T 4: 47,254,083 G300* probably null Het
Crlf1 G A 8: 70,498,828 C119Y probably damaging Het
Dcaf4 A T 12: 83,535,967 S279C probably damaging Het
Gde1 A T 7: 118,705,441 H70Q probably damaging Het
Gpt2 A T 8: 85,509,272 N179I probably damaging Het
Grik5 G A 7: 25,058,325 Q410* probably null Het
Hspa2 C T 12: 76,405,881 R450W probably damaging Het
Idh3b A T 2: 130,281,890 M118K probably benign Het
Ighv5-21 T C 12: 114,322,803 probably benign Het
Il12rb2 C T 6: 67,298,216 V642M possibly damaging Het
Iqcg A G 16: 33,049,943 V60A probably benign Het
Irx6 T A 8: 92,676,952 Y102N probably damaging Het
Itgb6 C T 2: 60,653,137 probably null Het
Mmp27 A T 9: 7,579,066 probably null Het
Olfr143 G T 9: 38,254,205 V263F probably damaging Het
Olfr175-ps1 T A 16: 58,824,559 Y50F probably benign Het
Olfr452 C A 6: 42,790,517 H159Q probably benign Het
Olfr50 T A 2: 36,793,338 M34K probably damaging Het
Olfr976 A T 9: 39,956,968 M1K probably null Het
Pcdhb16 A G 18: 37,479,873 R629G probably damaging Het
Pde3b A T 7: 114,519,575 M650L probably benign Het
Rfwd3 C T 8: 111,288,242 R326Q probably damaging Het
Skint3 T A 4: 112,235,742 M1K probably null Het
Strn T C 17: 78,692,426 Q127R possibly damaging Het
Taar2 T G 10: 23,941,029 W156G probably damaging Het
Trpt1 G T 19: 6,996,770 M45I probably benign Het
Ubap2l T C 3: 90,023,575 T357A probably damaging Het
Ubr3 C T 2: 70,021,181 R1831* probably null Het
Unc79 T A 12: 103,047,012 Y287* probably null Het
Utrn T A 10: 12,634,033 K2398N probably benign Het
Vav2 A T 2: 27,292,780 probably null Het
Vps9d1 A T 8: 123,247,967 H249Q possibly damaging Het
Vwf T A 6: 125,599,252 C432S probably damaging Het
Zfp760 C T 17: 21,723,305 P487L probably damaging Het
Zswim2 A C 2: 83,923,695 V207G possibly damaging Het
Other mutations in Zfp369
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00969:Zfp369 APN 13 65297260 missense probably benign 0.41
IGL01393:Zfp369 APN 13 65294474 missense possibly damaging 0.85
IGL02277:Zfp369 APN 13 65284932 missense probably damaging 1.00
IGL02986:Zfp369 APN 13 65280281 missense probably damaging 1.00
IGL02992:Zfp369 APN 13 65294451 missense possibly damaging 0.50
IGL03170:Zfp369 APN 13 65294410 missense probably damaging 0.99
IGL03351:Zfp369 APN 13 65296153 missense possibly damaging 0.95
R0136:Zfp369 UTSW 13 65297202 missense probably benign 0.08
R0600:Zfp369 UTSW 13 65296434 missense probably damaging 0.97
R0646:Zfp369 UTSW 13 65297548 missense probably damaging 1.00
R1190:Zfp369 UTSW 13 65292293 missense probably damaging 0.99
R1528:Zfp369 UTSW 13 65292165 missense probably damaging 1.00
R1934:Zfp369 UTSW 13 65297151 missense probably damaging 1.00
R2168:Zfp369 UTSW 13 65296948 missense probably benign 0.01
R4386:Zfp369 UTSW 13 65296992 missense probably benign 0.00
R4928:Zfp369 UTSW 13 65296800 missense possibly damaging 0.91
R5127:Zfp369 UTSW 13 65279033 start gained probably benign
R5549:Zfp369 UTSW 13 65297380 missense probably damaging 1.00
R5740:Zfp369 UTSW 13 65296767 missense probably benign
R5743:Zfp369 UTSW 13 65295680 missense probably benign 0.02
R5840:Zfp369 UTSW 13 65297278 missense possibly damaging 0.46
R6351:Zfp369 UTSW 13 65296230 missense possibly damaging 0.83
R7248:Zfp369 UTSW 13 65296117 missense probably damaging 0.98
R7288:Zfp369 UTSW 13 65285018 critical splice donor site probably null
R7314:Zfp369 UTSW 13 65292104 missense probably damaging 0.97
R7470:Zfp369 UTSW 13 65292146 missense probably benign 0.12
R7508:Zfp369 UTSW 13 65279273 missense unknown
R7796:Zfp369 UTSW 13 65296215 missense probably benign
R7886:Zfp369 UTSW 13 65292054 missense possibly damaging 0.95
R7969:Zfp369 UTSW 13 65292054 missense possibly damaging 0.95
Z1177:Zfp369 UTSW 13 65292160 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACAGAGGAAATCCATACATGAACTCTGC -3'
(R):5'- GCTTACGAAGCTGGGACACAGAC -3'

Sequencing Primer
(F):5'- agccagacttgaccttgac -3'
(R):5'- GACACAGACTTCTGGGGAC -3'
Posted On2014-01-15