Incidental Mutation 'R1191:Strn'
ID100847
Institutional Source Beutler Lab
Gene Symbol Strn
Ensembl Gene ENSMUSG00000024077
Gene Namestriatin, calmodulin binding protein
Synonyms
MMRRC Submission 039263-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.663) question?
Stock #R1191 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location78649913-78737196 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 78692426 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Arginine at position 127 (Q127R)
Ref Sequence ENSEMBL: ENSMUSP00000120830 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024881] [ENSMUST00000145910]
Predicted Effect probably benign
Transcript: ENSMUST00000024881
SMART Domains Protein: ENSMUSP00000024881
Gene: ENSMUSG00000024077

DomainStartEndE-ValueType
low complexity region 85 101 N/A INTRINSIC
low complexity region 178 195 N/A INTRINSIC
low complexity region 223 231 N/A INTRINSIC
low complexity region 259 276 N/A INTRINSIC
WD40 299 338 6.04e-8 SMART
WD40 352 391 2.42e-7 SMART
WD40 405 444 1.21e-7 SMART
WD40 493 539 1.28e1 SMART
WD40 542 581 4.4e-10 SMART
WD40 584 627 2.48e-4 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000145910
AA Change: Q127R

PolyPhen 2 Score 0.818 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000120830
Gene: ENSMUSG00000024077
AA Change: Q127R

DomainStartEndE-ValueType
low complexity region 17 45 N/A INTRINSIC
Pfam:Striatin 48 177 4.2e-50 PFAM
low complexity region 238 254 N/A INTRINSIC
low complexity region 331 348 N/A INTRINSIC
low complexity region 376 384 N/A INTRINSIC
low complexity region 412 429 N/A INTRINSIC
WD40 452 491 6.04e-8 SMART
WD40 505 544 2.42e-7 SMART
WD40 558 597 1.21e-7 SMART
WD40 646 692 1.28e1 SMART
WD40 695 734 4.4e-10 SMART
WD40 737 780 2.48e-4 SMART
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.3%
  • 10x: 95.1%
  • 20x: 87.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice heterozygous for a knock-out allele exhibit increased blood pressure and circulating aldosterone when fed a liberal salt diet. No mice could be generated that were homozygous for the allele. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd27 T C 7: 35,602,487 F144L probably damaging Het
C8b C T 4: 104,793,323 P377S probably damaging Het
Cfi C A 3: 129,868,527 T385N probably benign Het
Col15a1 G T 4: 47,254,083 G300* probably null Het
Crlf1 G A 8: 70,498,828 C119Y probably damaging Het
Dcaf4 A T 12: 83,535,967 S279C probably damaging Het
Gde1 A T 7: 118,705,441 H70Q probably damaging Het
Gpt2 A T 8: 85,509,272 N179I probably damaging Het
Grik5 G A 7: 25,058,325 Q410* probably null Het
Hspa2 C T 12: 76,405,881 R450W probably damaging Het
Idh3b A T 2: 130,281,890 M118K probably benign Het
Ighv5-21 T C 12: 114,322,803 probably benign Het
Il12rb2 C T 6: 67,298,216 V642M possibly damaging Het
Iqcg A G 16: 33,049,943 V60A probably benign Het
Irx6 T A 8: 92,676,952 Y102N probably damaging Het
Itgb6 C T 2: 60,653,137 probably null Het
Mmp27 A T 9: 7,579,066 probably null Het
Olfr143 G T 9: 38,254,205 V263F probably damaging Het
Olfr175-ps1 T A 16: 58,824,559 Y50F probably benign Het
Olfr452 C A 6: 42,790,517 H159Q probably benign Het
Olfr50 T A 2: 36,793,338 M34K probably damaging Het
Olfr976 A T 9: 39,956,968 M1K probably null Het
Pcdhb16 A G 18: 37,479,873 R629G probably damaging Het
Pde3b A T 7: 114,519,575 M650L probably benign Het
Rfwd3 C T 8: 111,288,242 R326Q probably damaging Het
Skint3 T A 4: 112,235,742 M1K probably null Het
Taar2 T G 10: 23,941,029 W156G probably damaging Het
Trpt1 G T 19: 6,996,770 M45I probably benign Het
Ubap2l T C 3: 90,023,575 T357A probably damaging Het
Ubr3 C T 2: 70,021,181 R1831* probably null Het
Unc79 T A 12: 103,047,012 Y287* probably null Het
Utrn T A 10: 12,634,033 K2398N probably benign Het
Vav2 A T 2: 27,292,780 probably null Het
Vps9d1 A T 8: 123,247,967 H249Q possibly damaging Het
Vwf T A 6: 125,599,252 C432S probably damaging Het
Zfp369 T A 13: 65,291,962 Y153* probably null Het
Zfp760 C T 17: 21,723,305 P487L probably damaging Het
Zswim2 A C 2: 83,923,695 V207G possibly damaging Het
Other mutations in Strn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00722:Strn APN 17 78692420 missense possibly damaging 0.89
IGL02165:Strn APN 17 78687620 missense probably damaging 1.00
IGL02424:Strn APN 17 78684351 missense probably damaging 1.00
IGL02473:Strn APN 17 78684293 missense possibly damaging 0.71
IGL03306:Strn APN 17 78667223 missense probably damaging 0.98
R0053:Strn UTSW 17 78656934 missense possibly damaging 0.92
R0053:Strn UTSW 17 78656934 missense possibly damaging 0.92
R0165:Strn UTSW 17 78677374 missense possibly damaging 0.89
R1156:Strn UTSW 17 78656931 missense probably damaging 0.99
R1256:Strn UTSW 17 78664617 critical splice donor site probably null
R1700:Strn UTSW 17 78692402 missense probably damaging 1.00
R1878:Strn UTSW 17 78677326 missense possibly damaging 0.81
R1897:Strn UTSW 17 78682842 missense probably benign 0.01
R1912:Strn UTSW 17 78684395 missense probably damaging 1.00
R1975:Strn UTSW 17 78692499 intron probably null
R2357:Strn UTSW 17 78655599 missense probably damaging 1.00
R3054:Strn UTSW 17 78682892 missense probably damaging 0.99
R3693:Strn UTSW 17 78656992 missense probably damaging 1.00
R3694:Strn UTSW 17 78656992 missense probably damaging 1.00
R3695:Strn UTSW 17 78656992 missense probably damaging 1.00
R3941:Strn UTSW 17 78657940 missense probably damaging 0.99
R4431:Strn UTSW 17 78736462 missense probably damaging 1.00
R4570:Strn UTSW 17 78677372 missense possibly damaging 0.95
R4678:Strn UTSW 17 78677351 missense probably damaging 1.00
R4729:Strn UTSW 17 78657961 missense probably damaging 0.98
R4947:Strn UTSW 17 78661779 missense probably damaging 0.98
R5470:Strn UTSW 17 78656945 missense probably benign 0.01
R5710:Strn UTSW 17 78687599 missense probably damaging 1.00
R5943:Strn UTSW 17 78669847 missense probably damaging 0.96
R6173:Strn UTSW 17 78700869 missense probably damaging 1.00
R6800:Strn UTSW 17 78670358 intron probably benign
R6846:Strn UTSW 17 78736457 missense probably damaging 0.97
R7716:Strn UTSW 17 78655775 missense probably damaging 0.99
R7746:Strn UTSW 17 78677372 missense probably benign 0.11
RF006:Strn UTSW 17 78677271 frame shift probably null
RF008:Strn UTSW 17 78677287 frame shift probably null
RF017:Strn UTSW 17 78677288 frame shift probably null
RF018:Strn UTSW 17 78677283 frame shift probably null
RF031:Strn UTSW 17 78677277 frame shift probably null
RF035:Strn UTSW 17 78677285 frame shift probably null
RF036:Strn UTSW 17 78677277 frame shift probably null
RF038:Strn UTSW 17 78677282 frame shift probably null
RF039:Strn UTSW 17 78677278 frame shift probably null
RF044:Strn UTSW 17 78677288 frame shift probably null
RF045:Strn UTSW 17 78677282 frame shift probably null
RF047:Strn UTSW 17 78677270 frame shift probably null
RF047:Strn UTSW 17 78677274 frame shift probably null
RF048:Strn UTSW 17 78677287 frame shift probably null
X0022:Strn UTSW 17 78700949 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAATAGGACAAGACAGtggatgatgagtaga -3'
(R):5'- TGTAATGACAGTTGGTGATTCGACAACAAA -3'

Sequencing Primer
(F):5'- aaaaacaagcccaaaagcaatag -3'
(R):5'- TTGGTGATTCGACAACAAAAAAGG -3'
Posted On2014-01-15